ID: 1148563959

View in Genome Browser
Species Human (GRCh38)
Location 17:48622236-48622258
Sequence GCCCTTGGCCTGAGAATAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148563950_1148563959 18 Left 1148563950 17:48622195-48622217 CCCACCGGCTTGGGGGCTAGGTT 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1148563959 17:48622236-48622258 GCCCTTGGCCTGAGAATAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 105
1148563951_1148563959 17 Left 1148563951 17:48622196-48622218 CCACCGGCTTGGGGGCTAGGTTT 0: 1
1: 0
2: 2
3: 10
4: 134
Right 1148563959 17:48622236-48622258 GCCCTTGGCCTGAGAATAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 105
1148563955_1148563959 -9 Left 1148563955 17:48622222-48622244 CCATCTTCCCCATGGCCCTTGGC 0: 1
1: 1
2: 3
3: 44
4: 431
Right 1148563959 17:48622236-48622258 GCCCTTGGCCTGAGAATAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 105
1148563952_1148563959 14 Left 1148563952 17:48622199-48622221 CCGGCTTGGGGGCTAGGTTTGCT 0: 1
1: 0
2: 1
3: 4
4: 102
Right 1148563959 17:48622236-48622258 GCCCTTGGCCTGAGAATAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148563959 Original CRISPR GCCCTTGGCCTGAGAATAGT TGG Exonic
900553417 1:3268147-3268169 GCCCTTCTCCTGAGACCAGTGGG - Intronic
900854171 1:5167350-5167372 GCCTTTGTTCTGAGAATCGTAGG + Intergenic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902411017 1:16211627-16211649 CCCCTTGGCTTGAGCATAGGTGG - Intronic
904861144 1:33538927-33538949 GCCCTAGGCATGAGAATGCTGGG - Intronic
908064801 1:60391249-60391271 GAACTTGGGCTGAGAATAGTTGG - Intergenic
908231991 1:62114218-62114240 GGCCTGGGCCTGAGCATCGTTGG + Exonic
908441394 1:64158431-64158453 GCCACTGGCCTGAGAATATGGGG - Intronic
912204232 1:107492948-107492970 GCCCTTGGCTTGACCATGGTTGG - Intergenic
915328097 1:155091737-155091759 GCCCCAGGCCTGAGAACAGAGGG - Intergenic
917142635 1:171852561-171852583 GCCATTTGTCAGAGAATAGTTGG + Intronic
918222324 1:182446022-182446044 GCCCTTGTCATCCGAATAGTAGG - Intergenic
922774730 1:228209388-228209410 GACCTTGGCCTGGGAAGAGCGGG - Intronic
1067836288 10:49643783-49643805 TCCCTTGGCCTGGGCAAAGTAGG - Intronic
1071736567 10:88307528-88307550 GCCCTTGGCTTGACTATTGTTGG - Intronic
1075055986 10:119218706-119218728 GCATTTGGCTTGAGAAAAGTTGG - Intronic
1076328980 10:129651163-129651185 GCCCTTGGCCTGTGTCCAGTGGG + Intronic
1076882179 10:133244999-133245021 GCCGTTGTCCTGTGAATGGTAGG - Intergenic
1080874971 11:36266654-36266676 GCCCTGGGCCTGAGCAGAGGTGG - Intergenic
1084448376 11:69217763-69217785 GCCCTGGGCCTGAGCCTAGGTGG + Intergenic
1086670846 11:89545649-89545671 GCCCCTGAACTGAAAATAGTTGG + Intergenic
1091406688 12:213737-213759 CCCCTTGTCCTGAGAGTCGTGGG + Intronic
1091938099 12:4449575-4449597 GCCCTAGGCCTGAGCAAAGAGGG + Intergenic
1096909081 12:54963815-54963837 GCCCTTGGCCTGAGAGGGGGTGG + Exonic
1101196350 12:102386722-102386744 GTCAGTGGCATGAGAATAGTGGG + Intergenic
1104282610 12:127391746-127391768 ACTCTTGGTCTGAGCATAGTGGG - Intergenic
1106223786 13:27770098-27770120 GCCTTTGGTCTGAGAACAGATGG - Intergenic
1108740048 13:53327555-53327577 GGCTTTGGCCTTAGAAAAGTTGG - Intergenic
1108854768 13:54779144-54779166 GCCCTTGGCTTGACAGTTGTTGG - Intergenic
1123062796 14:105601856-105601878 GCCCTGGGCCTGGGGATTGTGGG - Intergenic
1123505624 15:20939886-20939908 GCCCTTGGCCTGGGACGGGTTGG - Intergenic
1123599104 15:21950877-21950899 GCCCTTGGCCTGGGACGGGTTGG - Intergenic
1124641153 15:31397385-31397407 GCCCCAGGCCTGAGAATGGTCGG - Intronic
1125410298 15:39399109-39399131 GCCCTGATCATGAGAATAGTAGG - Intergenic
1128759297 15:70204562-70204584 GTCCTAAGCCTGAGAATTGTGGG - Intergenic
1130424411 15:83780711-83780733 GCCTTTGGCCTGAGACTATGGGG - Intronic
1202971210 15_KI270727v1_random:240727-240749 GCCCTTGGCCTGGGACGGGTTGG - Intergenic
1137665725 16:50247865-50247887 GCCCTTGGGCTTAAAAGAGTGGG + Intronic
1138318785 16:56093409-56093431 GCCCTGGGCCTGAGAATCCTAGG + Intergenic
1139758940 16:69168654-69168676 GCCCTGGGACTCAAAATAGTTGG - Intronic
1143904937 17:10200379-10200401 GCCCATGGCCAGAGAACAGATGG - Intergenic
1144051951 17:11504524-11504546 AGCCTTGGCCAGAGAATAGAAGG + Intronic
1145816456 17:27798410-27798432 GAGCTTGGCCTGAGAATGGGAGG - Intronic
1146545877 17:33738131-33738153 GCCAGTGGCCTGAGAAGAGCTGG - Intronic
1148563959 17:48622236-48622258 GCCCTTGGCCTGAGAATAGTTGG + Exonic
1148693387 17:49545530-49545552 GCCCTGGGCCAGAGGCTAGTGGG + Intergenic
1151912210 17:77091037-77091059 GTCTTTGGCCTAAGAATAATGGG + Intronic
1152811570 17:82385164-82385186 GCACTTGGCCTGGGAAAAGCCGG - Intergenic
1157299425 18:46468886-46468908 GCCCTGGGCCTGGGGACAGTAGG + Intergenic
1159914265 18:74174456-74174478 GCCCTTGGCCTGAGAGGTGACGG + Intergenic
1161346284 19:3770351-3770373 GCACCTGGCCTGAGAATACTTGG + Exonic
927710516 2:25322859-25322881 GCCCTTAGGGTGAGAATATTGGG - Intronic
928909739 2:36407586-36407608 GAACTTGGCCTGAGACCAGTTGG + Intronic
930090399 2:47527554-47527576 GGCCTTGGCCTCACAAGAGTAGG - Intronic
930417786 2:51110835-51110857 AGCCATGGCCTGAGAATAATTGG - Intergenic
931901384 2:66792291-66792313 GCAATCTGCCTGAGAATAGTTGG - Intergenic
931936587 2:67204482-67204504 GGGGTTGGGCTGAGAATAGTAGG - Intergenic
935377616 2:102415904-102415926 GCCCTAGGCATGAGTACAGTGGG - Intergenic
938121681 2:128638507-128638529 GCCCCTGGTCTGAGAAACGTGGG + Intergenic
940501091 2:154494397-154494419 GCCCTTTGCCTCAGCAGAGTTGG - Intergenic
941420184 2:165274877-165274899 GTCCTTGGCTTGAGAACAGAAGG - Intronic
1168852656 20:987268-987290 GCTCTGGGCCTGAGGATGGTTGG + Intronic
1172538808 20:35695306-35695328 GACCTTGGCCTGAATATAGGAGG - Intronic
1173835478 20:46122596-46122618 GCCCTAGGTCTGAGAAGAGAAGG - Exonic
1179355687 21:40656756-40656778 GCCATTGGCCTGAAATGAGTAGG - Intronic
1180963859 22:19775728-19775750 GCTCCTGGCCTCAGAATATTCGG - Intronic
1183597010 22:38818829-38818851 ACCCTTGGCCTGAGTAAACTTGG - Exonic
1185036139 22:48478031-48478053 GCACTTGGACTGAGAAGAGAAGG + Intergenic
949327831 3:2887047-2887069 GCTCTTCGCCAGATAATAGTTGG - Exonic
950448039 3:13049309-13049331 GCCCTGGGCCTGGGAACAGTGGG - Intronic
952173343 3:30834169-30834191 TCCCTTTGCCTGACAAAAGTTGG + Intronic
955628729 3:60949169-60949191 TTCCTTCGCTTGAGAATAGTGGG - Intronic
959046012 3:101474571-101474593 GCCTTTGGGCTGAGAATATGGGG + Intronic
962010408 3:131385605-131385627 GCCCTTGGTCTTAGAAGAATGGG + Intronic
965207482 3:165740950-165740972 GCCCAAGGCCTGAGAATCCTGGG - Intergenic
974099638 4:57402589-57402611 GCTTTTGGCCAGAGTATAGTTGG + Intergenic
975667647 4:76748891-76748913 CCACGTGGCCTGACAATAGTAGG + Intronic
982215519 4:153079813-153079835 TCCCTTGGCCTGGGAAGTGTGGG + Intergenic
986271277 5:6233028-6233050 GCCCTGGGGCTGAGAAGAGGAGG + Intergenic
987061633 5:14249051-14249073 GCCCATAGGCTGAGAATAGACGG + Intronic
990777025 5:59314358-59314380 GCTCTTGGCCTTATAATGGTAGG + Intronic
998136413 5:139676588-139676610 GCCCAAGGCCTGAGAAGAGGAGG - Intronic
999383498 5:151138394-151138416 GCCCTTGGCCTCAGGAGTGTTGG + Intronic
1000415259 5:160977484-160977506 TACCTTGGCCTGAGAATATGGGG + Intergenic
1001843627 5:174901882-174901904 GCCCAAGGGCTGAGAAGAGTGGG + Intergenic
1006228492 6:32561420-32561442 GCAATTGGCCTGGGAATGGTCGG + Intronic
1008578161 6:52881256-52881278 CACCTTGTCCTGAGAGTAGTTGG + Intronic
1009864534 6:69380276-69380298 CCTCTTGGCCAGAGAATAGTAGG + Intronic
1011885895 6:92094924-92094946 GCATTTGTCCTGAGAATAATTGG - Intergenic
1016834558 6:148464468-148464490 GCCCCAGGCCTGAGGATGGTGGG - Intronic
1017370845 6:153705878-153705900 AGCCTTGGCCAGAGCATAGTGGG + Intergenic
1018499931 6:164396337-164396359 GGCCTTGGCCTAAGACTAGATGG + Intergenic
1021278037 7:18680200-18680222 GCCATTGGCCTAAAAATTGTGGG + Intronic
1023376414 7:39560345-39560367 GACCTTGGAATAAGAATAGTAGG - Intergenic
1024403809 7:48954329-48954351 GTCCTTGAACTGATAATAGTGGG - Intergenic
1025479756 7:60967674-60967696 GCCCTTGGCCTGATTACAGAAGG + Intergenic
1028707283 7:93864779-93864801 GCTTTGGGCCTGTGAATAGTGGG + Intronic
1029122686 7:98279325-98279347 GCCCCTGGCCAGAGAATACTGGG - Intronic
1029549805 7:101231762-101231784 GCCCTGGGCCTGAGCATGGATGG - Intergenic
1032096400 7:128940413-128940435 GGCCTTGGCCCTAGAATAGAGGG - Intronic
1037293991 8:17381615-17381637 GTCTTTGGCCTGAGAAAAGCCGG - Intronic
1037309497 8:17539599-17539621 GTCCTTGGCCTTAGAATATAAGG - Intronic
1043291246 8:78604207-78604229 GCCATTAGCGTAAGAATAGTTGG - Exonic
1043538579 8:81233317-81233339 GCCCCTGGCCTGAGATGTGTGGG + Intergenic
1044830384 8:96241780-96241802 GCCCCTAGCCTGAGAATTATTGG + Intronic
1046742952 8:117847775-117847797 GCCCTGGGGGTGAGAACAGTAGG - Intronic
1048289209 8:133167283-133167305 GGCCTTGCCCAGATAATAGTTGG - Intergenic
1060820634 9:126659488-126659510 GCCCCTGGCCTGAGAATGTGTGG - Intronic
1185991681 X:4898266-4898288 GCCCTAGGCCTTAGAATGGAGGG - Intergenic
1194920216 X:99756711-99756733 GTCCTTGGCTTGAGTATTGTTGG + Intergenic
1195162722 X:102186243-102186265 GCAGTTGGCCTGAGAATGATGGG - Intergenic
1197769476 X:130081107-130081129 GCCAGTGCCCTGAGCATAGTAGG + Intronic
1197857950 X:130937859-130937881 GCTGAAGGCCTGAGAATAGTTGG + Intergenic