ID: 1148564842

View in Genome Browser
Species Human (GRCh38)
Location 17:48626679-48626701
Sequence CCCTCCCGCTGCAGGAAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 270}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148564821_1148564842 17 Left 1148564821 17:48626639-48626661 CCACGTAACCTCAGCCCCAGCTA 0: 1
1: 0
2: 1
3: 5
4: 124
Right 1148564842 17:48626679-48626701 CCCTCCCGCTGCAGGAAGGGGGG 0: 1
1: 0
2: 0
3: 23
4: 270
1148564825_1148564842 3 Left 1148564825 17:48626653-48626675 CCCCAGCTACCGGCCGCCCGGTC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1148564842 17:48626679-48626701 CCCTCCCGCTGCAGGAAGGGGGG 0: 1
1: 0
2: 0
3: 23
4: 270
1148564827_1148564842 1 Left 1148564827 17:48626655-48626677 CCAGCTACCGGCCGCCCGGTCCC 0: 1
1: 0
2: 0
3: 21
4: 300
Right 1148564842 17:48626679-48626701 CCCTCCCGCTGCAGGAAGGGGGG 0: 1
1: 0
2: 0
3: 23
4: 270
1148564828_1148564842 -6 Left 1148564828 17:48626662-48626684 CCGGCCGCCCGGTCCCCCCCTCC 0: 1
1: 0
2: 2
3: 82
4: 1032
Right 1148564842 17:48626679-48626701 CCCTCCCGCTGCAGGAAGGGGGG 0: 1
1: 0
2: 0
3: 23
4: 270
1148564820_1148564842 24 Left 1148564820 17:48626632-48626654 CCGGCGGCCACGTAACCTCAGCC 0: 1
1: 0
2: 0
3: 6
4: 70
Right 1148564842 17:48626679-48626701 CCCTCCCGCTGCAGGAAGGGGGG 0: 1
1: 0
2: 0
3: 23
4: 270
1148564829_1148564842 -10 Left 1148564829 17:48626666-48626688 CCGCCCGGTCCCCCCCTCCCGCT 0: 1
1: 0
2: 1
3: 64
4: 1476
Right 1148564842 17:48626679-48626701 CCCTCCCGCTGCAGGAAGGGGGG 0: 1
1: 0
2: 0
3: 23
4: 270
1148564823_1148564842 9 Left 1148564823 17:48626647-48626669 CCTCAGCCCCAGCTACCGGCCGC 0: 1
1: 0
2: 1
3: 38
4: 358
Right 1148564842 17:48626679-48626701 CCCTCCCGCTGCAGGAAGGGGGG 0: 1
1: 0
2: 0
3: 23
4: 270
1148564826_1148564842 2 Left 1148564826 17:48626654-48626676 CCCAGCTACCGGCCGCCCGGTCC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1148564842 17:48626679-48626701 CCCTCCCGCTGCAGGAAGGGGGG 0: 1
1: 0
2: 0
3: 23
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148564842 Original CRISPR CCCTCCCGCTGCAGGAAGGG GGG Intronic