ID: 1148565480

View in Genome Browser
Species Human (GRCh38)
Location 17:48630625-48630647
Sequence TGAGTCTGAAGAAATACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148565480_1148565482 3 Left 1148565480 17:48630625-48630647 CCAGAGGTATTTCTTCAGACTCA 0: 1
1: 0
2: 0
3: 27
4: 237
Right 1148565482 17:48630651-48630673 TCACAGTCCAGACCCACTCTGGG 0: 1
1: 0
2: 0
3: 10
4: 169
1148565480_1148565487 21 Left 1148565480 17:48630625-48630647 CCAGAGGTATTTCTTCAGACTCA 0: 1
1: 0
2: 0
3: 27
4: 237
Right 1148565487 17:48630669-48630691 CTGGGAAAGAGTGAGGCATGAGG 0: 1
1: 1
2: 4
3: 50
4: 503
1148565480_1148565481 2 Left 1148565480 17:48630625-48630647 CCAGAGGTATTTCTTCAGACTCA 0: 1
1: 0
2: 0
3: 27
4: 237
Right 1148565481 17:48630650-48630672 ATCACAGTCCAGACCCACTCTGG 0: 1
1: 0
2: 0
3: 3
4: 105
1148565480_1148565484 14 Left 1148565480 17:48630625-48630647 CCAGAGGTATTTCTTCAGACTCA 0: 1
1: 0
2: 0
3: 27
4: 237
Right 1148565484 17:48630662-48630684 ACCCACTCTGGGAAAGAGTGAGG 0: 1
1: 0
2: 2
3: 123
4: 1831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148565480 Original CRISPR TGAGTCTGAAGAAATACCTC TGG (reversed) Intronic
904206126 1:28856427-28856449 TAATTCTGAAGCGATACCTCAGG + Intronic
904236464 1:29120645-29120667 AGAGGCTGAAGAAATTCCTGAGG + Exonic
905153692 1:35955065-35955087 TGAGTCTGAAGAGTTAGCTAGGG + Intronic
908650848 1:66331459-66331481 TGAATCTAAACAAATACTTCAGG - Intronic
912439281 1:109686539-109686561 TGAGTCTGAAGAAACTCCCCAGG + Intronic
912442592 1:109710981-109711003 TGAGTCTGAAGAAACTCCCCAGG + Intergenic
914750592 1:150532414-150532436 TGACTCAGATGAAATACCCCAGG + Intergenic
916206047 1:162317294-162317316 TGAGTCTGAGGACACACCACTGG - Intronic
916914525 1:169391875-169391897 TGGGTCTGAAGAAACTCCCCAGG - Intronic
917133192 1:171763216-171763238 TGAGTCTGAATAAATAGATGGGG + Intergenic
919815260 1:201433454-201433476 TGAGTCTGAAGGATCACCTGAGG - Intergenic
920932478 1:210401529-210401551 TGAGTCTGTCAAAATGCCTCTGG - Intronic
921391534 1:214619762-214619784 TGAGAATGCAGAAGTACCTCTGG + Intronic
924062670 1:240192350-240192372 TGATTCTGAAGAAATAATGCTGG + Intronic
1063105942 10:2992435-2992457 TGGGTCTGAAGAAACTCCCCAGG + Intergenic
1065617702 10:27545876-27545898 TAAATCTGTAGAAATATCTCAGG + Intergenic
1067023270 10:42820509-42820531 TGCGTCTGAAGAAACATCGCTGG + Exonic
1067146405 10:43697283-43697305 TGAGTCTAAAGAAACAGCCCAGG - Intergenic
1069113985 10:64481159-64481181 TTAGTCTGAGAAAATACCTTGGG - Intergenic
1069509428 10:69030557-69030579 TGGATCTGAAGAAATTCCGCAGG - Intergenic
1070874121 10:79785347-79785369 TGACTCAGAAGAACTACCACTGG + Intergenic
1071218305 10:83433163-83433185 GGAGTCTGAAGAAACTCCCCAGG + Intergenic
1072959015 10:99912826-99912848 TGTGTCTTCAGAAATACCTTGGG - Intronic
1073457866 10:103648405-103648427 AGAGTCTAAAGTAATACTTCTGG + Intronic
1073762979 10:106650493-106650515 TGGGTATTATGAAATACCTCAGG + Intronic
1076442183 10:130487566-130487588 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
1077265362 11:1645960-1645982 TGATTTTGAAGCAATACTTCAGG + Intergenic
1077942179 11:6854944-6854966 TGAGTCTGAAGAAACTCCGCAGG + Intergenic
1078985533 11:16592241-16592263 TGAGTCTGGAAGAATTCCTCTGG - Intronic
1079424047 11:20323545-20323567 TGAGTCAGGAGAATCACCTCTGG - Intergenic
1081223824 11:40496652-40496674 TGAATGTGAAGACATAACTCAGG - Intronic
1083517962 11:63278399-63278421 GGAGTCTGAAGAAATATCACAGG + Intronic
1086193444 11:84108426-84108448 TGAAACTGAAGAAAGACCTAGGG + Intronic
1086594207 11:88551840-88551862 TGACTCTGAAGAATTAACACTGG + Intronic
1088074292 11:105827236-105827258 TTAGTCTGAATAAATACTTTTGG - Intronic
1088185505 11:107163164-107163186 TGAGTATCAAGAAAAACATCAGG + Intergenic
1088786894 11:113190403-113190425 TGAGTCTGCAGTATTACATCTGG - Intronic
1089945600 11:122469440-122469462 TGTTTCTGCAGAAATATCTCAGG - Intergenic
1094640724 12:32272585-32272607 TCAGTCTGAAGAAATTCCCCAGG - Intronic
1096968993 12:55650498-55650520 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
1097838837 12:64301374-64301396 GGGGTCTGAAGAAACTCCTCAGG + Intronic
1098679162 12:73328457-73328479 TGGGTCTGAAGAAACTCCCCAGG + Intergenic
1100177492 12:92047596-92047618 TGATTCTGAAGAACAACCTATGG - Intronic
1100741515 12:97598486-97598508 TCAGACTGAAGAAAAACCTGGGG + Intergenic
1100919035 12:99461532-99461554 TGAGTGTGAAGGAATACTACTGG - Intronic
1101516768 12:105443532-105443554 TGAGGCTGAAAAATGACCTCAGG + Intergenic
1101714787 12:107301236-107301258 TGGGTCTGAATAAATCACTCTGG + Intergenic
1101866119 12:108521040-108521062 AGAGTTTTAAGAAGTACCTCTGG - Exonic
1102651226 12:114443977-114443999 GGAGTGTGAAGCAATCCCTCCGG - Intergenic
1104610177 12:130221165-130221187 TGAGTCTGAAAGAATACATGCGG - Intergenic
1105714623 13:23050343-23050365 TGGGTCTGAAGAAACTCCCCAGG + Intergenic
1108941256 13:55957074-55957096 TTGCTCTGAAGAAATACCTGTGG - Intergenic
1109218608 13:59617522-59617544 TGGGTCTGAGAAAAAACCTCAGG + Intergenic
1112286222 13:98106900-98106922 TTGCTCTGAAGAAATACCTGAGG + Intergenic
1113776495 13:112949057-112949079 AGAGTCTGTAGTGATACCTCTGG - Intronic
1114039633 14:18665032-18665054 AAAGTCTCAAGAAATAGCTCTGG - Intergenic
1114044676 14:18863583-18863605 AAAGTCTCAAGAAATAGCTCTGG - Intergenic
1114119547 14:19655942-19655964 AAAGTCTCAAGAAATAGCTCTGG + Intergenic
1116072027 14:40059316-40059338 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
1116333076 14:43619699-43619721 TGAGCCTGAAGAAATTCCCCAGG + Intergenic
1116365701 14:44060255-44060277 TGTGTGTGAAGAGATATCTCTGG + Intergenic
1116997403 14:51337900-51337922 TGAGACTGAAGAGAGACCTCAGG - Intergenic
1117728099 14:58694051-58694073 GGAGGCTGAAGAAATAGGTCCGG + Intergenic
1118884343 14:69853933-69853955 TGAGCCTAAAGGAATTCCTCTGG + Intergenic
1123424424 15:20157691-20157713 TGCGTCTGAAGAAACATCGCTGG + Intergenic
1124672914 15:31657663-31657685 TGAGGTTTAAGAAATACATCTGG - Intronic
1125049142 15:35277443-35277465 TTACTCTAAAGAAATACCTGAGG - Intronic
1125404572 15:39338939-39338961 TCAGTCAGAAGAAAGGCCTCTGG + Intergenic
1125525295 15:40370395-40370417 TGGATCTGGAGAAATACCTTCGG - Exonic
1126386563 15:48099504-48099526 TGATTCTTAAGATATACCACAGG - Intergenic
1126580946 15:50242220-50242242 AGAGTCTGAGGATATACTTCAGG - Exonic
1127600000 15:60525871-60525893 TGAGAAGGAAGAAATATCTCTGG + Intronic
1127793714 15:62420789-62420811 TGGGTCTGAAGAAACTCCCCAGG + Intronic
1133112924 16:3560116-3560138 TGAGAATGAAGAATTACCCCTGG + Intronic
1136747314 16:32602238-32602260 GGAGTCTGTAGAACTTCCTCAGG + Intergenic
1138118299 16:54377842-54377864 TCACTATGAAGAAATACCTGAGG - Intergenic
1141435500 16:83997450-83997472 GGAGCCTCAAGAAATACCCCCGG - Intronic
1141870852 16:86784524-86784546 TGAAGATGAAGAAATAACTCAGG + Intergenic
1141892074 16:86932975-86932997 TGAGTTGGTAGAAGTACCTCTGG + Intergenic
1203049449 16_KI270728v1_random:861444-861466 GGAGTCTGTAGAACTTCCTCAGG + Intergenic
1203121952 16_KI270728v1_random:1546384-1546406 TGCGTCTGAAGAAACATCGCTGG - Intergenic
1146544833 17:33729068-33729090 TCACTATGAAGAAATACCTGAGG + Intronic
1146828440 17:36045508-36045530 AGAGTTTAAAGAAATCCCTCTGG - Intergenic
1148198188 17:45729857-45729879 TGGGCCTGGAGAAATCCCTCAGG - Intergenic
1148565480 17:48630625-48630647 TGAGTCTGAAGAAATACCTCTGG - Intronic
1148678835 17:49461250-49461272 TGACTCTGCTGAAATGCCTCAGG - Intronic
1149268441 17:54952642-54952664 TGTACCTGAATAAATACCTCAGG - Intronic
1150114951 17:62539415-62539437 TGAGTCTGAAGACAGAGCCCTGG - Intronic
1153111961 18:1601590-1601612 TGTGTCTCAAAAAATAACTCTGG + Intergenic
1155288011 18:24311303-24311325 TCAGTCTGAATAATTACGTCAGG - Intronic
1156751272 18:40458809-40458831 TGAATCTGAAGACCTACATCTGG - Intergenic
1156796344 18:41050892-41050914 GGGGTCTGAAGAAATGCCCCAGG + Intergenic
1157726533 18:49968614-49968636 TGGGTCTGAAGAAACTCCCCAGG - Intronic
1157757576 18:50232197-50232219 TGAGTCTGAAGGAATAGATGGGG - Intronic
1157776124 18:50397552-50397574 TGGGTCTGAAGAAACTCCCCTGG - Intergenic
1157776430 18:50400190-50400212 TGAGTCTAAAGAAACTCCCCAGG - Intergenic
1158001166 18:52620949-52620971 GGAGACAGAAGCAATACCTCTGG - Intronic
1158729950 18:60011403-60011425 TCACTCTAAAGAAATACCTGAGG + Intergenic
1159932398 18:74327151-74327173 TGAGTCTGAAGAAACTCCCCAGG + Intronic
1162550016 19:11353498-11353520 GGAGACTGAAGAGATACCGCAGG + Exonic
1164041952 19:21500707-21500729 GGGGTCTGAAGAAATTCCCCAGG - Intronic
929846261 2:45531804-45531826 TGAGTCTGAAGAAAGAACAAAGG - Intronic
932487916 2:72096233-72096255 TGAATCTGAATAAAAAACTCTGG - Intergenic
934138587 2:89022019-89022041 AGAGGCTGAAAAAATACCTATGG - Intergenic
934230658 2:90178544-90178566 AGAGGCTGAAAAAATACCTATGG + Intergenic
934458818 2:94199343-94199365 TGCGTCTGAAGAAACATCGCTGG - Intergenic
935158083 2:100501748-100501770 GGAGTCTGATGTAATTCCTCAGG - Intergenic
935426443 2:102923501-102923523 TGAGACTGAAGAAATAAATGTGG + Intergenic
936230307 2:110694734-110694756 TGAGTCTGAAGGAATAGTTTAGG - Intergenic
936256056 2:110913631-110913653 TTGCTCTGAAGAAATACCTGAGG + Intronic
936482916 2:112901779-112901801 TGGGTCTGAAGAAACTCCCCAGG + Intergenic
936702443 2:115029471-115029493 TCAGTCTGAAGAACTCCCTTTGG + Intronic
937084136 2:119159255-119159277 CAATTCTGAAGAAATAACTCAGG - Intergenic
937898565 2:126997727-126997749 TGGGTCTGAAGAAACTCCCCAGG + Intergenic
937920346 2:127124488-127124510 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
939042553 2:137208371-137208393 TGGGTCTGAAGAAATTCCCCAGG - Intronic
939785114 2:146499958-146499980 TGGGTCTGAAGAAACTCCTCAGG + Intergenic
940076033 2:149743275-149743297 TGAATCTGGAGAAAGACCTGGGG + Intergenic
940389533 2:153115968-153115990 TAAGTCTAAAAAAATACCACTGG - Intergenic
940617245 2:156064125-156064147 TGATGCTGAAGAAATAGCTAAGG - Intergenic
942193260 2:173492534-173492556 TGAGTCTCAGGAAACACCTATGG + Intergenic
942537051 2:176976159-176976181 TGATTTTGAAGAAATAACTGAGG + Intergenic
942612626 2:177757695-177757717 TGAGTGTAAAGAAGTACCTGTGG + Intronic
942801799 2:179884053-179884075 TGGGTCTGAAAAATTTCCTCAGG + Intergenic
943666030 2:190609431-190609453 GGGGTCTGAAGAAACTCCTCGGG - Intergenic
946627674 2:221631534-221631556 TTAGTCTGAAGTAATTCCTTAGG - Intergenic
948602329 2:239114450-239114472 TGAGTCAGCAGAAATACCTAAGG - Intronic
1170717687 20:18846170-18846192 TCACTGTGAAGAAATACCTAAGG - Intergenic
1174929403 20:54795834-54795856 TTAGTCTGAAGAATTTCCTTTGG + Intergenic
1177173077 21:17675423-17675445 GGAGTCTGAAGAAACTCCCCAGG + Intergenic
1178402416 21:32298289-32298311 TGAGTCTGAACAAATGCAGCCGG + Intronic
1179436544 21:41366218-41366240 TGAGTTTGCTGAAATACCCCAGG + Intronic
1180463199 22:15586140-15586162 AAAGTCTCAAGAAATAGCTCTGG - Intergenic
1181357389 22:22307107-22307129 TGCGTCTGAAGAAACATCGCTGG + Intergenic
1181559230 22:23690338-23690360 TGAGTCTGGAGAAACAGCTACGG - Intronic
1181745859 22:24954367-24954389 TGTGTCTGTACAAATTCCTCGGG - Intronic
1183863932 22:40689367-40689389 TGGGTCTGAAGAAACACCCCAGG - Intergenic
1185146654 22:49140858-49140880 ATTGTTTGAAGAAATACCTCGGG + Intergenic
1185196695 22:49475299-49475321 TGAGTCTTAAGATAAAGCTCAGG + Intronic
949239905 3:1858680-1858702 TGAGTATCAAGAAATAACACAGG - Intergenic
950630994 3:14281923-14281945 TTAGTATAAAGAAATACCTGAGG - Intergenic
950996675 3:17505484-17505506 TCACTGTGAAGAAATACCTGAGG - Intronic
955537284 3:59937509-59937531 TTAGTGTGAATAAATATCTCTGG + Intronic
955639739 3:61069381-61069403 TGATTCTGAAGCAATTGCTCTGG + Intronic
956369392 3:68542016-68542038 ACAGTCTAAAGAAAAACCTCAGG + Intronic
956380172 3:68656813-68656835 TGGGTCTGAAGAAACTCCCCAGG + Intergenic
957137170 3:76304055-76304077 TGTGGCTGAAGAATTAACTCTGG - Intronic
957454707 3:80426571-80426593 AAAGACTGAAGAAATGCCTCAGG - Intergenic
957605297 3:82390892-82390914 TGAGTCTGTAACAATACCTTGGG - Intergenic
959188724 3:103082134-103082156 TCACTCTAAAGAAATACCTGAGG - Intergenic
963607508 3:147423763-147423785 TGAGTCTACAGAACTACTTCTGG - Intronic
964128701 3:153264102-153264124 TGAGTCTGAAGATGGAGCTCTGG + Intergenic
966407058 3:179608824-179608846 TGGGTCTGAAGAAACTCCCCAGG - Intronic
970825463 4:20267801-20267823 TAAAACTTAAGAAATACCTCTGG + Intronic
971632986 4:29018903-29018925 TGAGTCTGAAGGAAAATGTCTGG + Intergenic
972187709 4:36551540-36551562 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
972760354 4:42097167-42097189 TGAGTCTGGAAAAATATGTCTGG + Intergenic
973944365 4:55942312-55942334 TGCGTTTTAAGAATTACCTCTGG + Intergenic
975363323 4:73498136-73498158 TGAGTTTATAGAAATAACTCAGG + Intronic
976668164 4:87622537-87622559 TGATTCTGAAGAACTAGCACAGG - Intergenic
976822705 4:89224720-89224742 TGAGTCTGAGGGATTCCCTCTGG + Intergenic
977028294 4:91848933-91848955 TGTGTCTAGAGAAATCCCTCAGG - Intergenic
977139690 4:93353097-93353119 TGAGGCTGAAGACATGACTCAGG + Intronic
977580061 4:98715105-98715127 TGAGTTTGTAGAAATACCTATGG + Intergenic
979333456 4:119442141-119442163 TAAGACTGAAGATGTACCTCAGG + Intergenic
979963845 4:127053636-127053658 TTAGTGTGAAGAAATTACTCTGG - Intergenic
980446704 4:132919908-132919930 TGTGTCTGAATTGATACCTCTGG - Intergenic
981167787 4:141582157-141582179 TCAGTCTGAAGAAACTCCCCAGG - Intergenic
982134438 4:152259692-152259714 TAAGTGTGAAGAAAGACGTCTGG - Intergenic
983794374 4:171842451-171842473 TCACTATGAAGAAATACCTGAGG + Intronic
987719147 5:21612440-21612462 GGAGTCTGAATAAACTCCTCAGG - Intergenic
988894220 5:35654455-35654477 TGACTATGGAGAAAGACCTCAGG - Intronic
990068350 5:51747193-51747215 TGGCTCTAAAGAAATACCTGAGG + Intergenic
990495171 5:56339913-56339935 TGAGTCAGAAGAAACATCACTGG + Intergenic
991595861 5:68304685-68304707 AGAGTCTGAAGCATCACCTCAGG + Intergenic
992550969 5:77859540-77859562 TGAGGAAGAAGAAAAACCTCTGG + Intronic
993853213 5:93037236-93037258 TGAGCCTGGAGAAATGCCACCGG - Intergenic
993873531 5:93279423-93279445 TGAGTGTGCAGAAATACATGTGG + Intergenic
994262616 5:97678038-97678060 TCAGTCTGATGAAATTCCTGAGG + Intergenic
995096727 5:108244751-108244773 TGAGGCTGAAGTTATACATCAGG + Intronic
996683306 5:126251948-126251970 TGATTCTAAAGAAATACATAAGG + Intergenic
996884768 5:128341835-128341857 TCTGTCTGAAGAAATATCACAGG + Intronic
997973468 5:138423802-138423824 TGAGACCTAAGAAATACCTTTGG - Intronic
998461354 5:142312614-142312636 TGAGTCAGAAGAGCTACCCCAGG - Exonic
1000727103 5:164785095-164785117 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
1000945172 5:167413557-167413579 TGTGTTTGGATAAATACCTCAGG - Intronic
1003130536 6:3391755-3391777 TGAGTCTGAAGAAATTGTTTGGG + Intronic
1003699520 6:8446505-8446527 GGGGTCTGAAGAAATTCCCCAGG - Intergenic
1003966311 6:11255804-11255826 TCAGTGTGAAGGAATCCCTCTGG + Intronic
1004455931 6:15791422-15791444 TGGGTCTGAAGAAACTCCTCTGG - Intergenic
1007239651 6:40415846-40415868 TGAATCTGAACAAATAGCACTGG + Intronic
1007664777 6:43507749-43507771 TGTGTCTGATGACATACCTAAGG - Intronic
1007678917 6:43621089-43621111 AGAGTCTGAAGAAATGGCACAGG - Exonic
1008897947 6:56579531-56579553 TGAGTCTGAAAAAATGCTGCTGG + Intronic
1009345274 6:62607342-62607364 TTAGTCTGAAGAAATGACACAGG + Intergenic
1010740723 6:79500617-79500639 TGAATCTGCACAAATACTTCAGG + Intronic
1010741942 6:79517408-79517430 TTAGTCTCAAGAAATACCTAGGG - Intronic
1011411789 6:87074023-87074045 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
1012575832 6:100796585-100796607 TGTGTATGAAGAGAGACCTCTGG - Intronic
1012937816 6:105386721-105386743 TGGGTCTGAAGAATTACCTGAGG + Intronic
1016979059 6:149837645-149837667 GGAGTCTGAAGAATTAAGTCGGG - Intronic
1018217824 6:161547821-161547843 TAAGTGGAAAGAAATACCTCTGG - Intronic
1019487698 7:1296819-1296841 GGAGTCTGGAGAAATGCCACCGG - Intergenic
1021868974 7:24984979-24985001 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
1022478852 7:30729871-30729893 TTGGTCTGAGGAAAGACCTCGGG - Intronic
1022626976 7:32046948-32046970 TGTGTCTGTAGAACTCCCTCAGG + Intronic
1022936842 7:35186668-35186690 TAAGTCTGAAGAACTTCCTGTGG + Intergenic
1024191006 7:47009655-47009677 TGGGTCTGAAGAAACTCCCCAGG + Intergenic
1024667145 7:51558468-51558490 TGGGTATGAAGAAATACCCAAGG - Intergenic
1024732904 7:52273068-52273090 TGGGTCTGAAGAAATTCCCCAGG + Intergenic
1024906457 7:54387809-54387831 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
1024906936 7:54393723-54393745 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
1026870498 7:73848285-73848307 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
1027686274 7:81281978-81282000 GGGGTCTGATGAAATACCTCAGG + Intergenic
1028236141 7:88363866-88363888 TGAGTCTGAAGAAACTCCCCAGG - Intergenic
1028309456 7:89312473-89312495 TGAGTGAGAAGAAATTACTCTGG - Intronic
1029885783 7:103869912-103869934 AGAGTTTGAAGAAAGACTTCAGG - Intronic
1032538999 7:132687941-132687963 AGAGTCTGAAGAAGCACCCCAGG + Intronic
1038188378 8:25296224-25296246 TGATTCTGACTAAATTCCTCTGG - Intronic
1040492483 8:47937509-47937531 TGAGTCTGAAAAAATGGCTCTGG - Intronic
1041569204 8:59317453-59317475 TTAATGTGAAGAAATACCTAAGG - Intergenic
1041800831 8:61796454-61796476 TTAGCCTGAAGAAATCCCTATGG + Intergenic
1043159295 8:76825988-76826010 TCACTCTGAAGAAATATCTGAGG + Intronic
1046635015 8:116665054-116665076 AGAGTCTGAAGTAATAGCTGTGG - Intronic
1047021185 8:120776448-120776470 GGAGTCTGTAGAAATGGCTCAGG - Intronic
1047172126 8:122503897-122503919 TAAGTCCAAAGAAATACATCTGG + Intergenic
1049933370 9:477245-477267 TGAGTCATAAGAATTACCTTAGG - Intronic
1050063501 9:1734842-1734864 TGAAGCTGAAGAAATCCCTGAGG + Intergenic
1050554749 9:6779425-6779447 TGGGTCTGAAGAAATAGTTCTGG + Intronic
1050803226 9:9641735-9641757 TGGGTCTGAAGAAACTCCCCAGG + Intronic
1051647568 9:19283893-19283915 TGTGTCTCAAGAAATGCATCTGG - Intronic
1052572000 9:30238098-30238120 TAAATCTGAAGAAATGTCTCTGG - Intergenic
1052735868 9:32342133-32342155 TGAGTCTCCCCAAATACCTCAGG + Intergenic
1053689314 9:40575136-40575158 TGCGTCTGAAGAAACATCGCTGG - Intergenic
1054433694 9:65193266-65193288 TGCGTCTGAAGAAACATCTCTGG - Intergenic
1054496691 9:65828403-65828425 TGCGTCTGAAGAAACATCTCTGG + Intergenic
1056228649 9:84522424-84522446 TGGGTCTGAAGAAACTCCCCAGG + Intergenic
1056419769 9:86412714-86412736 CTAGTCTGAAGAAATGCTTCAGG - Intergenic
1056709650 9:88980482-88980504 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
1057860705 9:98638670-98638692 AGAGTCTGAAGAAACTCCCCAGG + Intronic
1058177883 9:101759185-101759207 TGAGTCTCTAGAAATAATTCAGG + Intergenic
1058178557 9:101767651-101767673 TGAGACTGGAGAAATACAACTGG - Intergenic
1058596527 9:106621493-106621515 TGACTCTTGAGAAATACATCTGG + Intergenic
1185687072 X:1938061-1938083 TGAGTTTGGAGAAATCCCACTGG - Intergenic
1185995129 X:4938170-4938192 TGACTCTGTGTAAATACCTCAGG - Intergenic
1186410197 X:9340139-9340161 TAAGTCTGCAGAATTACCTGGGG + Intergenic
1186942510 X:14526390-14526412 TGATTCTGAACAAATCACTCTGG + Intergenic
1187208920 X:17209753-17209775 TGGGTCTGAAGAAACTCCCCAGG + Intergenic
1187385901 X:18848108-18848130 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
1188167555 X:26880450-26880472 TGGGTCTGAAGAAACTCCCCAGG - Intergenic
1188167998 X:26886081-26886103 TGGGTCTGAAGAAAATCCCCAGG - Intergenic
1189527135 X:41834897-41834919 TGAGTCTGAAGAATTAGATGGGG - Intronic
1190489692 X:50969293-50969315 TGAGTCTGAAGAAACTCCCCAGG - Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1194472249 X:94310898-94310920 TGAGACTGGAGAAATATCTAAGG + Intergenic
1194894237 X:99419582-99419604 TGACTCTGAAATAATACCTGGGG - Intergenic
1195523508 X:105858517-105858539 TGAGCCTGAAATTATACCTCTGG - Intronic
1196074104 X:111555935-111555957 TGAGTCTCAAGAAACTCCTCAGG - Intergenic
1196085563 X:111679868-111679890 TGGGTCTGAAGAAACTCCCCAGG - Intronic
1197476827 X:126935435-126935457 TAAATCTGAAGAAATATCTTTGG - Intergenic
1197761145 X:130029277-130029299 TGAGGCTGAAGGAATTCCACTGG + Intronic
1198715695 X:139555674-139555696 GGTCTCTGAAGAAATACTTCAGG + Intronic
1201344032 Y:12963135-12963157 TGAGGCTAAAGAATTACCTCAGG - Intergenic
1201939485 Y:19444333-19444355 TGGGTCTGAAGAAATTCCCCAGG + Intergenic