ID: 1148569583

View in Genome Browser
Species Human (GRCh38)
Location 17:48657489-48657511
Sequence CTCTACAGTGAAGGAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148569576_1148569583 29 Left 1148569576 17:48657437-48657459 CCATCATAAGTGAACCAAAGACT No data
Right 1148569583 17:48657489-48657511 CTCTACAGTGAAGGAATTTCTGG No data
1148569578_1148569583 15 Left 1148569578 17:48657451-48657473 CCAAAGACTCTGGAAGTATGAGA No data
Right 1148569583 17:48657489-48657511 CTCTACAGTGAAGGAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148569583 Original CRISPR CTCTACAGTGAAGGAATTTC TGG Intergenic
No off target data available for this crispr