ID: 1148570001

View in Genome Browser
Species Human (GRCh38)
Location 17:48660651-48660673
Sequence CTGTTCACACAGATAAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148570001_1148570004 5 Left 1148570001 17:48660651-48660673 CCTAGTTTTATCTGTGTGAACAG No data
Right 1148570004 17:48660679-48660701 ATAGGTTATGATAAAGGCTCAGG No data
1148570001_1148570003 -1 Left 1148570001 17:48660651-48660673 CCTAGTTTTATCTGTGTGAACAG No data
Right 1148570003 17:48660673-48660695 GTTTTAATAGGTTATGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148570001 Original CRISPR CTGTTCACACAGATAAAACT AGG (reversed) Intergenic
No off target data available for this crispr