ID: 1148571982

View in Genome Browser
Species Human (GRCh38)
Location 17:48677685-48677707
Sequence CTGTGAAAAAGGAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148571982_1148571991 28 Left 1148571982 17:48677685-48677707 CCTCCCTCCCTCCTTTTTCACAG No data
Right 1148571991 17:48677736-48677758 GCAAATGGAGATTCTTGATTTGG No data
1148571982_1148571989 13 Left 1148571982 17:48677685-48677707 CCTCCCTCCCTCCTTTTTCACAG No data
Right 1148571989 17:48677721-48677743 CAGATCTCTTCCACTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148571982 Original CRISPR CTGTGAAAAAGGAGGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr