ID: 1148572187

View in Genome Browser
Species Human (GRCh38)
Location 17:48678798-48678820
Sequence CTATGCTTCTGGAAGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148572187_1148572195 8 Left 1148572187 17:48678798-48678820 CCTGCACCCTTCCAGAAGCATAG No data
Right 1148572195 17:48678829-48678851 ATACATGGATAATTACTTCCTGG No data
1148572187_1148572192 -7 Left 1148572187 17:48678798-48678820 CCTGCACCCTTCCAGAAGCATAG No data
Right 1148572192 17:48678814-48678836 AGCATAGATCCCTGGATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148572187 Original CRISPR CTATGCTTCTGGAAGGGTGC AGG (reversed) Intergenic
No off target data available for this crispr