ID: 1148572263

View in Genome Browser
Species Human (GRCh38)
Location 17:48679479-48679501
Sequence CATCTTATAATGAAGGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148572263_1148572267 24 Left 1148572263 17:48679479-48679501 CCTCCTACCTTCATTATAAGATG No data
Right 1148572267 17:48679526-48679548 ATACCAACCGTGCAATTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148572263 Original CRISPR CATCTTATAATGAAGGTAGG AGG (reversed) Intergenic
No off target data available for this crispr