ID: 1148572267

View in Genome Browser
Species Human (GRCh38)
Location 17:48679526-48679548
Sequence ATACCAACCGTGCAATTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148572265_1148572267 21 Left 1148572265 17:48679482-48679504 CCTACCTTCATTATAAGATGGAT No data
Right 1148572267 17:48679526-48679548 ATACCAACCGTGCAATTACCAGG No data
1148572263_1148572267 24 Left 1148572263 17:48679479-48679501 CCTCCTACCTTCATTATAAGATG No data
Right 1148572267 17:48679526-48679548 ATACCAACCGTGCAATTACCAGG No data
1148572266_1148572267 17 Left 1148572266 17:48679486-48679508 CCTTCATTATAAGATGGATTCTA No data
Right 1148572267 17:48679526-48679548 ATACCAACCGTGCAATTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148572267 Original CRISPR ATACCAACCGTGCAATTACC AGG Intergenic
No off target data available for this crispr