ID: 1148574934

View in Genome Browser
Species Human (GRCh38)
Location 17:48703768-48703790
Sequence TCTCTTTTTTTATGCTTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148574934_1148574938 9 Left 1148574934 17:48703768-48703790 CCAATTAAGCATAAAAAAAGAGA No data
Right 1148574938 17:48703800-48703822 AGGCAACCCACTCTCCTGTTGGG No data
1148574934_1148574941 20 Left 1148574934 17:48703768-48703790 CCAATTAAGCATAAAAAAAGAGA No data
Right 1148574941 17:48703811-48703833 TCTCCTGTTGGGCTGTGAACTGG No data
1148574934_1148574937 8 Left 1148574934 17:48703768-48703790 CCAATTAAGCATAAAAAAAGAGA No data
Right 1148574937 17:48703799-48703821 TAGGCAACCCACTCTCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148574934 Original CRISPR TCTCTTTTTTTATGCTTAAT TGG (reversed) Intergenic
No off target data available for this crispr