ID: 1148574937

View in Genome Browser
Species Human (GRCh38)
Location 17:48703799-48703821
Sequence TAGGCAACCCACTCTCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148574934_1148574937 8 Left 1148574934 17:48703768-48703790 CCAATTAAGCATAAAAAAAGAGA No data
Right 1148574937 17:48703799-48703821 TAGGCAACCCACTCTCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148574937 Original CRISPR TAGGCAACCCACTCTCCTGT TGG Intergenic
No off target data available for this crispr