ID: 1148578320

View in Genome Browser
Species Human (GRCh38)
Location 17:48726627-48726649
Sequence ACTGTTCCTCAGGAGCGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148578320_1148578325 -3 Left 1148578320 17:48726627-48726649 CCAGGCCGCTCCTGAGGAACAGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1148578325 17:48726647-48726669 AGTCCAGCAGCCAGTGGCCTGGG 0: 1
1: 1
2: 1
3: 34
4: 300
1148578320_1148578327 1 Left 1148578320 17:48726627-48726649 CCAGGCCGCTCCTGAGGAACAGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1148578327 17:48726651-48726673 CAGCAGCCAGTGGCCTGGGAAGG 0: 1
1: 1
2: 9
3: 58
4: 452
1148578320_1148578332 16 Left 1148578320 17:48726627-48726649 CCAGGCCGCTCCTGAGGAACAGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1148578332 17:48726666-48726688 TGGGAAGGGTGTTGTCTCTAGGG 0: 1
1: 0
2: 0
3: 18
4: 172
1148578320_1148578323 -9 Left 1148578320 17:48726627-48726649 CCAGGCCGCTCCTGAGGAACAGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1148578323 17:48726641-48726663 AGGAACAGTCCAGCAGCCAGTGG 0: 1
1: 0
2: 2
3: 24
4: 263
1148578320_1148578333 17 Left 1148578320 17:48726627-48726649 CCAGGCCGCTCCTGAGGAACAGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1148578333 17:48726667-48726689 GGGAAGGGTGTTGTCTCTAGGGG 0: 1
1: 0
2: 1
3: 8
4: 160
1148578320_1148578324 -4 Left 1148578320 17:48726627-48726649 CCAGGCCGCTCCTGAGGAACAGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1148578324 17:48726646-48726668 CAGTCCAGCAGCCAGTGGCCTGG 0: 1
1: 1
2: 2
3: 24
4: 329
1148578320_1148578331 15 Left 1148578320 17:48726627-48726649 CCAGGCCGCTCCTGAGGAACAGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1148578331 17:48726665-48726687 CTGGGAAGGGTGTTGTCTCTAGG 0: 1
1: 0
2: 2
3: 23
4: 236
1148578320_1148578328 2 Left 1148578320 17:48726627-48726649 CCAGGCCGCTCCTGAGGAACAGT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1148578328 17:48726652-48726674 AGCAGCCAGTGGCCTGGGAAGGG 0: 1
1: 0
2: 3
3: 46
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148578320 Original CRISPR ACTGTTCCTCAGGAGCGGCC TGG (reversed) Exonic
901644334 1:10708642-10708664 ACTGTGCTTCAGAACCGGCCAGG - Intronic
901873171 1:12150496-12150518 CCTCTTCCTCAGGAGAGGCCTGG - Intergenic
905007226 1:34719544-34719566 ACTGCTTCTCAGGTGGGGCCTGG - Intronic
905366422 1:37454054-37454076 ACTGTCCATCTGGAGGGGCCTGG - Intergenic
906109537 1:43313524-43313546 ACTCTTTGTCAGGAGGGGCCTGG - Intronic
906532324 1:46530883-46530905 ACTCTTCCTCTGCAGCAGCCAGG + Intergenic
916416763 1:164599573-164599595 ACTGTCCCTCAGGAGGGGAGGGG + Intronic
919469154 1:197957490-197957512 TCTGTTCCTCAGGAGCACTCAGG - Intergenic
920491682 1:206420562-206420584 GGGGTTCCTCAGGAGTGGCCTGG + Intronic
921358141 1:214305745-214305767 CCAGTGCCTCAGGAGCAGCCAGG + Intronic
924164944 1:241271510-241271532 ACTGTTTCACAGGAGTGCCCAGG + Intronic
924567677 1:245211940-245211962 ACTGCTCCTCAGCGGGGGCCTGG + Intronic
1065402712 10:25324187-25324209 ACTGTTTCGCACGAGAGGCCTGG + Intronic
1073215808 10:101835517-101835539 ACAGTTCCTAAGGAGCAGGCAGG - Intronic
1077245670 11:1536282-1536304 CCCGTTCCTCAGGAGCGGCTAGG + Intergenic
1077303126 11:1856216-1856238 TCTGTTCCCCATGAGCGACCAGG + Intronic
1077830079 11:5857862-5857884 AATGTTGCTCAGGAGAGGCTAGG - Intronic
1078984065 11:16573178-16573200 ACTGTTCCTCAGAAGTGACAAGG + Intronic
1081667688 11:44926176-44926198 ACTGTTCCTCGTGACCTGCCTGG - Intronic
1083698880 11:64461142-64461164 ACTGTCCCTCTGGAGGGGCCAGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1092297338 12:7210848-7210870 AGCGGTCCTCAGGAGCTGCCAGG + Intronic
1102573709 12:113843155-113843177 ACTGTTCCCAAGGTGCTGCCTGG + Intronic
1103780343 12:123394623-123394645 ACTCTTCCCCAAGAGCTGCCTGG - Intronic
1105449799 13:20489298-20489320 CCTGTTCCTCCGGAGAGGCTGGG + Intronic
1112145616 13:96696562-96696584 ACTGTTCCTGGGGATCGGCCAGG - Intronic
1112326978 13:98448064-98448086 ACTGTACCTCAGGAACGCCTGGG + Intronic
1115904080 14:38187627-38187649 GCTGGTACTCAGGAGAGGCCTGG + Intergenic
1118588561 14:67381213-67381235 AATGTTCATCAGGAGGGGACGGG - Intronic
1119069558 14:71568864-71568886 ACAGTTCCTCTGGAGAGGCCAGG + Intronic
1121410021 14:93743369-93743391 ACTGTTCCCCAGGAGCTGAAAGG + Intronic
1121924224 14:97913556-97913578 ACTGGTCCTCTGGAGAGTCCGGG - Intergenic
1122630751 14:103106769-103106791 ACTGGTCCTGGGGAGGGGCCAGG - Exonic
1123716898 15:23040115-23040137 CCTGTTCCTCAGGGGCGGCTTGG + Intergenic
1124914563 15:33957091-33957113 ACTGTTCCTGAGGAGCTCACAGG - Intronic
1126106080 15:45147899-45147921 ACTTTTCCTCAGGAGAGCCTGGG - Exonic
1130537689 15:84798772-84798794 AGTGTTCCTCAGCCGCGGCCTGG - Exonic
1130957983 15:88640455-88640477 ACAGTTCCTGAGGACCTGCCTGG - Intronic
1135789143 16:25377414-25377436 ACTATTACACAGGAGAGGCCGGG - Intergenic
1136416627 16:30108246-30108268 ACTCTTCCTCATGATCAGCCTGG + Exonic
1139651535 16:68364740-68364762 ACTGCTCCTCTGGTGAGGCCGGG - Exonic
1140386640 16:74546116-74546138 ACTGTTCTTCAGGAGAGTACTGG + Intronic
1141206717 16:81938595-81938617 ACAGTTCCTCAGCATCAGCCTGG - Intronic
1142166078 16:88589255-88589277 ACAGTTCCTCAGAAGCTCCCGGG + Intronic
1142191590 16:88720658-88720680 ACTCTTCCTCCAGAGCGGCTTGG + Exonic
1143754621 17:9057230-9057252 ACAGTTTCTCAAGAGAGGCCTGG + Intronic
1146958602 17:36952965-36952987 CCTGTTCCTCAGCAGCACCCAGG - Exonic
1147191306 17:38739585-38739607 CCTGATGCTCAGCAGCGGCCGGG + Exonic
1148578320 17:48726627-48726649 ACTGTTCCTCAGGAGCGGCCTGG - Exonic
1151619701 17:75238293-75238315 ACTGTTCCACAGGAGGGAACTGG + Exonic
1152216190 17:79034048-79034070 AGGCTTCCTCAGGAGCTGCCTGG + Intronic
1161904180 19:7142858-7142880 ACCGTTCCTCAGGGGTGTCCTGG + Exonic
925142007 2:1557341-1557363 CCTCTTCCTCAGGGGAGGCCTGG + Intergenic
925207966 2:2023351-2023373 CCTGTTTCCCAGGAGCTGCCTGG + Intronic
925872349 2:8282274-8282296 TCTGTTCCTCTGGAGCACCCTGG - Intergenic
931721396 2:65069962-65069984 GCTGGGCCTCAGGACCGGCCGGG + Intronic
932284278 2:70519196-70519218 CCTGTTCCTTAGGACCTGCCAGG - Intronic
933794520 2:85908800-85908822 CCTGTTGCTTAGGAGAGGCCTGG + Intergenic
936984083 2:118291479-118291501 ACTTTTCCACAGGAGCATCCAGG + Intergenic
948908909 2:240993231-240993253 AATGTTCCCCATGAGCAGCCAGG - Intronic
1171488288 20:25499164-25499186 ATTGCTCCTCAGGAGCTGCTGGG - Intronic
1171879103 20:30603558-30603580 ACTGTTCCTAAGGACAAGCCAGG + Intergenic
1174375032 20:50120902-50120924 ACTGTTCTTTAGAAGGGGCCTGG - Intronic
1176373757 21:6077311-6077333 ATTCTTCCACAGGGGCGGCCAGG + Intergenic
1177603982 21:23355300-23355322 ACTGTTCTTCCTGAGGGGCCTGG - Intergenic
1177606733 21:23389066-23389088 ACTCTTCCTCAGGAGTGTCTTGG - Intergenic
1178235686 21:30838470-30838492 ACAGCTCCTCAGGAGGGGCTGGG - Intergenic
1178270238 21:31182785-31182807 AGTGATCCTCAGGAGAGGACAGG + Intronic
1178525555 21:33325348-33325370 ACGGGTCCTCGGGAGCGCCCGGG + Intronic
1179403456 21:41106045-41106067 ACTGTCCCTGAGGAGCAGCGAGG + Intergenic
1179606549 21:42519452-42519474 CCTGTCCCTTAGGAGGGGCCAGG - Intronic
1179749720 21:43460932-43460954 ATTCTTCCACAGGGGCGGCCAGG - Intergenic
1179946826 21:44684138-44684160 ACTGTTTCTCATGAGAAGCCAGG - Intronic
1180016497 21:45088952-45088974 AGTGTTCCTCAGAAGTGTCCAGG + Intronic
1181003362 22:19998305-19998327 TCTGTCCCTCAGGAGAAGCCTGG - Intronic
1182489973 22:30665043-30665065 GGTGCTCCTCAGGTGCGGCCTGG + Intronic
1183465535 22:37978397-37978419 ACTCCTCCTCAGGGGCTGCCAGG - Intronic
1184404827 22:44293892-44293914 ACTCTTCATCAGCAGCCGCCAGG + Intronic
949133864 3:538202-538224 ACTGTTTCTCAGGGGCTTCCAGG - Intergenic
950099073 3:10346200-10346222 CCTGGTCCTCGGGAGGGGCCTGG + Intronic
953545039 3:43858124-43858146 ACTGTTCCTGAGGAGCGGTGTGG + Intergenic
955028062 3:55189394-55189416 ACTGTTCTTCAGTAGGGGGCAGG + Intergenic
961653894 3:128430981-128431003 ACTGCTCCTCAGGACTGGCATGG - Intergenic
969543731 4:7810521-7810543 ACTCTTCCTCAGGAGCCCCTCGG + Intronic
971355830 4:25894501-25894523 GCTGTTCCTCTGGAGAGCCCTGG - Intronic
972431389 4:38985883-38985905 TCTGTTTCTCAGGAGAGGACAGG + Intronic
974695610 4:65366180-65366202 ACTGTAACTCAGGAGAGGGCTGG - Intronic
991474397 5:67004235-67004257 CCCGCTCCTCAGGCGCGGCCGGG + Intronic
993277778 5:85883566-85883588 ACTGTTGCTCAGGACAGCCCAGG - Intergenic
996732384 5:126728455-126728477 ACTGTCCCTCAGGAGGAGTCAGG + Intergenic
997366314 5:133327471-133327493 ACTGGCTCTCAGGAGGGGCCTGG + Intronic
1001218220 5:169875629-169875651 ACTGTTGCTCAGGAAGGGTCAGG - Intronic
1001415100 5:171540086-171540108 AGTGTTCCTCAGGAGCACCTGGG - Intergenic
1003683579 6:8279306-8279328 ACGGTTCCACATGAGAGGCCTGG + Intergenic
1005943609 6:30579927-30579949 GCTGTTCCTCAGATACGGCCTGG - Exonic
1010017925 6:71125828-71125850 ACTGTTCCTCATGGGAGGGCTGG + Intergenic
1017769945 6:157637246-157637268 ACTCTTCCTCAGGAGCTACAGGG - Intronic
1018634477 6:165848733-165848755 ACTGTTCCTCTGGAACAGCAAGG - Intronic
1019887987 7:3922008-3922030 CCTGTTACTCAGGAGCCGCAGGG + Intronic
1023327783 7:39078728-39078750 TCTGTTCCTCTGGGGCAGCCTGG - Intronic
1025007668 7:55366583-55366605 CCTGCTCCTCAGAAGTGGCCTGG + Intronic
1035832168 8:2708286-2708308 ACTGTTCCTCAGTGGCGGAATGG - Intergenic
1039654818 8:39392149-39392171 GTTGTTTCTCAGGAGCAGCCAGG - Intergenic
1044915973 8:97112962-97112984 TCTGGGCCTCAGGAGAGGCCTGG + Intronic
1047725793 8:127682980-127683002 ACTGTACCTGTGGAGCGACCTGG - Intergenic
1056003886 9:82246879-82246901 ACTGTACCTCTGGACCTGCCTGG - Intergenic
1059404558 9:114091990-114092012 ACTGCTCCTTAGGTGGGGCCGGG - Exonic
1062651728 9:137581259-137581281 CCTGTTCTTCAGGAGCCCCCAGG + Intergenic
1198768083 X:140098671-140098693 AATCTTCTTCAGGAGCTGCCAGG + Intergenic
1200165341 X:154031578-154031600 ACAGGTCCTCAGGGGCAGCCAGG - Intronic
1200703422 Y:6421477-6421499 ACTGAGCATCAGGAGCTGCCAGG - Intergenic
1200919174 Y:8597809-8597831 ACACTGCCTCAGGAGCTGCCAGG + Intergenic
1201030688 Y:9743230-9743252 ACTGAGCATCAGGAGCTGCCAGG + Intergenic