ID: 1148578738

View in Genome Browser
Species Human (GRCh38)
Location 17:48728659-48728681
Sequence TTGGATTCCCCCGGCCTGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148578738_1148578745 29 Left 1148578738 17:48728659-48728681 CCACCCAGGCCGGGGGAATCCAA 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1148578745 17:48728711-48728733 TCGCCTGCATTCGCTCAGCACGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148578738 Original CRISPR TTGGATTCCCCCGGCCTGGG TGG (reversed) Exonic
900902474 1:5526494-5526516 GTGGACTCCTCCTGCCTGGGAGG - Intergenic
900999557 1:6142027-6142049 TTGGGGTCCCTCAGCCTGGGAGG - Intronic
901629203 1:10640180-10640202 TCGGCTTCCCCTGGCTTGGGAGG + Intronic
902203823 1:14852890-14852912 TTGGATTCAGCAGGTCTGGGAGG - Intronic
902559886 1:17270820-17270842 TTGGAGTCCAGAGGCCTGGGGGG - Intronic
903306163 1:22414719-22414741 CTGGAATCTCCCAGCCTGGGGGG - Intergenic
903809942 1:26029592-26029614 TGGGATGCAGCCGGCCTGGGGGG - Exonic
909185079 1:72477228-72477250 TTGCATTCCTCCAGGCTGGGTGG - Intergenic
912756998 1:112332944-112332966 TTGGACACGCCTGGCCTGGGAGG - Intergenic
915309277 1:154999384-154999406 TTTGCCTCCCCCGGCCTTGGGGG + Intergenic
915642680 1:157241281-157241303 TTGGAATCCCCTTGGCTGGGGGG - Intergenic
921269277 1:213452743-213452765 TGGGATCCCGCCAGCCTGGGAGG - Intergenic
1064229121 10:13514115-13514137 CTTAATTCCCCAGGCCTGGGAGG + Intronic
1069915173 10:71782825-71782847 TAGGCTTCACCCTGCCTGGGGGG - Intronic
1070601938 10:77872350-77872372 GTGGACTCCCCCAGCCAGGGAGG - Intronic
1070742583 10:78912654-78912676 CTGGATTCCCCCAGGCTGTGGGG + Intergenic
1075793628 10:125103558-125103580 TTGGGCTCCCTCTGCCTGGGTGG - Intronic
1077095775 11:798407-798429 GTGGGTTCCCCCGGGCAGGGTGG + Exonic
1077983066 11:7321363-7321385 TTATATTCCCCCTGCCTGGGTGG - Intronic
1080009235 11:27440848-27440870 TTTGATTCCATCGACCTGGGTGG - Intronic
1083334249 11:61913540-61913562 CTGGATTCCCCCGCCAGGGGTGG - Intronic
1084707008 11:70821380-70821402 TTGTAGTCCCCAGGACTGGGAGG + Intronic
1085311671 11:75520610-75520632 TTGGATCCCACCTGCATGGGAGG + Intronic
1085461766 11:76698320-76698342 TTGGCTTCACTGGGCCTGGGCGG + Intergenic
1090818110 11:130315844-130315866 TTGGCTTCCCCTGGCCAGGCGGG + Intergenic
1093206603 12:16259119-16259141 TAGGATTCCTTCAGCCTGGGAGG - Intronic
1096229318 12:49888565-49888587 TTGGATTCCCCAGGGCAGGCTGG + Intronic
1098425876 12:70365865-70365887 CTCGATCCGCCCGGCCTGGGCGG + Intergenic
1099215830 12:79852695-79852717 CTTGATTCCCCTGGGCTGGGTGG + Intronic
1105967553 13:25398434-25398456 TTGGAATCCCCTTGGCTGGGAGG + Intronic
1106842189 13:33695724-33695746 CTGGATTTCCCTTGCCTGGGTGG + Intergenic
1107096081 13:36537474-36537496 TTGGATGGCCCCTGGCTGGGTGG + Intergenic
1112456119 13:99565530-99565552 TTGGATCCCGCCGTCCTGAGGGG + Intergenic
1115546683 14:34470531-34470553 TGGGATTCCCCCTGCCTGCTAGG + Intergenic
1118224748 14:63888304-63888326 TTGGGTATCCCAGGCCTGGGTGG + Intronic
1118886430 14:69870651-69870673 TAGGATTCCCCCTTCATGGGTGG + Intronic
1122268041 14:100555836-100555858 CGGGATTGCCCAGGCCTGGGCGG - Intronic
1125316863 15:38441312-38441334 TTGGGCTCCCACTGCCTGGGTGG - Intergenic
1127103143 15:55587906-55587928 CCGAATTCCCGCGGCCTGGGGGG - Intronic
1128654917 15:69453369-69453391 TTGAATTCCCCCGGTCGTGGAGG + Intronic
1132728423 16:1348788-1348810 TTGGGCTCCCCGGCCCTGGGTGG + Exonic
1134735156 16:16493803-16493825 TTGGTTTGCCCAGGCCTGAGCGG + Intergenic
1134932364 16:18218414-18218436 TTGGTTTGCCCAGGCCTGAGCGG - Intergenic
1136235543 16:28911366-28911388 GTGGATTCCACAGGACTGGGTGG + Intronic
1139529879 16:67537822-67537844 TGGGAATCCCCCTGCCTGGAGGG + Intronic
1142338893 16:89508155-89508177 TTGTATTCCCAGGGCCTGGCGGG - Intronic
1142774163 17:2123168-2123190 AGGGCTTCCCCAGGCCTGGGTGG + Intronic
1148578738 17:48728659-48728681 TTGGATTCCCCCGGCCTGGGTGG - Exonic
1151618898 17:75232985-75233007 TTGGCTTCCCAGGGACTGGGTGG + Intronic
1152635448 17:81428866-81428888 TGGGAGTCCCCCTGGCTGGGTGG + Intronic
1152702330 17:81825251-81825273 GTGGATTCCCCTGGGCTGGGAGG - Exonic
1153534773 18:6089133-6089155 CTGGTTTCCCCAGGCCTGAGGGG - Intronic
1153794516 18:8609830-8609852 TTGAAGTCGGCCGGCCTGGGGGG - Exonic
1160357320 18:78239166-78239188 TTGGAGCCCCCCTGACTGGGGGG + Intergenic
1161134834 19:2613616-2613638 GTGGATTCCCCTAACCTGGGCGG + Intronic
1161751577 19:6101403-6101425 TGGGTTTCCACTGGCCTGGGTGG + Intronic
1162334639 19:10052902-10052924 TTGGATACCACCGGCCAGTGGGG + Intergenic
1163476928 19:17532076-17532098 CTGGAGCCCCCCGCCCTGGGTGG - Intronic
1163527546 19:17830772-17830794 GTGGATTCTCCAGCCCTGGGAGG + Intronic
1163952805 19:20606333-20606355 TTGGATTTACCCGGCCTGAATGG - Intronic
1163961907 19:20704548-20704570 TTGGATTTACCCGGCCTGAATGG + Intronic
1164190283 19:22909637-22909659 TTGGATTCATCTGGCCTGGAGGG - Intergenic
1166819546 19:45569086-45569108 TTGGTCTCTCCAGGCCTGGGAGG - Intronic
1166979194 19:46622791-46622813 GAGGATTGCTCCGGCCTGGGAGG - Intronic
925749092 2:7071326-7071348 TTGGATTTCCCTAGCATGGGAGG + Intergenic
927025543 2:19065118-19065140 TTGGATTCTCACACCCTGGGAGG - Intergenic
930028258 2:47043003-47043025 TTCGATTCCCCCTGGCTGTGAGG + Intronic
934897747 2:98133189-98133211 TTGGACTCCACAGGGCTGGGTGG + Intronic
936396981 2:112138625-112138647 TCGGAATCCCGCTGCCTGGGAGG - Exonic
937224340 2:120359685-120359707 TGGGCTTCTGCCGGCCTGGGAGG + Intergenic
938760027 2:134416506-134416528 TTGCACTCCTCCAGCCTGGGTGG - Intronic
948033846 2:234841774-234841796 TTGGCTTCCTCCAGGCTGGGTGG - Intergenic
1170122419 20:12925567-12925589 TTGCAGTCCCCAAGCCTGGGAGG + Intergenic
1171092348 20:22297036-22297058 GTGGATTCCGCCGGGCGGGGCGG - Intergenic
1172128047 20:32636884-32636906 TTGGTTTGCCCAGGCCTGAGGGG - Intergenic
1174725798 20:52860506-52860528 TTCCATCCCCCCGGCCTGGTAGG + Intergenic
1174950455 20:55036135-55036157 TCGGACTCCCCTGGCTTGGGTGG + Intergenic
1175100288 20:56574569-56574591 TTGGCTTCCCCCTGGCTGGGTGG + Intergenic
1175924949 20:62466990-62467012 GTGGGGCCCCCCGGCCTGGGAGG - Intronic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1176205944 20:63888198-63888220 CTAGAGTCCCCGGGCCTGGGAGG + Intronic
1177410343 21:20721588-20721610 TTTGCTTCCCTCCGCCTGGGCGG - Intergenic
1179710017 21:43208007-43208029 CGGGGTTCCCCCTGCCTGGGAGG + Intergenic
1179817177 21:43914181-43914203 TTGGAACCCCCCTGCCTGCGAGG + Intronic
1183616127 22:38946882-38946904 TTGGATTCTCCCGGGCCAGGCGG - Intergenic
953564134 3:44016646-44016668 TTTGATTCCCTCTGCCTGGCAGG + Intergenic
953672614 3:44975857-44975879 TGGGAGTCCCCCGGCCCGTGAGG + Intronic
954405161 3:50341364-50341386 GTGGATTCCCTTGGCATGGGTGG + Exonic
954664577 3:52245217-52245239 TTGGCTTTCCCCGTCCTGAGAGG - Intergenic
956021392 3:64937071-64937093 TTGGGTTCCCCAGGCATGGATGG + Intergenic
966339897 3:178914208-178914230 TTGGCTTCCCGCTGCCTAGGAGG + Intergenic
967565246 3:190964757-190964779 TTGGAGTACCCCGCCCTGTGAGG + Intergenic
967737104 3:192964870-192964892 TTGGAGTACCCCGCCCTGTGAGG + Intergenic
969567120 4:7985121-7985143 TAGGATGCCCACTGCCTGGGCGG + Intronic
970416365 4:15861765-15861787 TTGGACTCCCACTGCCTGGGAGG - Intergenic
982650287 4:158080025-158080047 TTGGATTCCCCCATCTTGTGTGG + Intergenic
997933616 5:138091905-138091927 CTGGTTTCCCCAGGCGTGGGTGG - Intronic
1000022771 5:157333074-157333096 TGGGATTCCAACGGCCTGGCGGG - Intronic
1006290103 6:33128267-33128289 TTGCCTGCCCCCGGCCTAGGAGG + Intergenic
1006670613 6:35727864-35727886 TTGGGTACCCCAGGCTTGGGTGG - Intronic
1007125430 6:39422264-39422286 ATGGAGTCCCCCAGCCTTGGCGG + Intronic
1007494147 6:42247981-42248003 TTGGACTCGCCCGGAATGGGAGG - Intronic
1019549655 7:1595656-1595678 TTGGAATCCGGGGGCCTGGGTGG + Intergenic
1022098337 7:27154666-27154688 TTGGATTCCCTCTGCCTCCGAGG - Exonic
1026682131 7:72474984-72475006 TTTGATTCCCCAGGCTTGGGGGG - Intergenic
1047361932 8:124177341-124177363 TTGGATTCTCCAGGCCAGAGTGG - Intergenic
1049604974 8:143525164-143525186 TTGGCTTCTCCTGGCCTGGGTGG + Intronic
1049684583 8:143934218-143934240 TTGGGTTCCCCCGCCGGGGGCGG + Intronic
1052991202 9:34520331-34520353 CTGGATTTCCCTGGCCTGGAAGG + Intronic
1057307669 9:93921592-93921614 ATGTATTGCCCCGGCCTGTGTGG + Intergenic
1061191538 9:129085382-129085404 TTGGATGCCCCTGGGGTGGGAGG + Intronic
1061365994 9:130172655-130172677 TTGGATTTCCCCATCCTCGGCGG - Exonic
1062338053 9:136081187-136081209 TGGGTTTCCAGCGGCCTGGGTGG - Intronic
1062362173 9:136193328-136193350 TGGGCGTCCCCCGGCCTGGCGGG + Intergenic
1062471972 9:136710091-136710113 TAGGCTTCTCCCGGCCTGGAGGG - Intergenic
1186722737 X:12323156-12323178 TTGGATGCCCCCATTCTGGGTGG + Intronic