ID: 1148579519

View in Genome Browser
Species Human (GRCh38)
Location 17:48734129-48734151
Sequence CCGGAGCCTGCGCTTGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148579512_1148579519 2 Left 1148579512 17:48734104-48734126 CCTGCGGGGCTATAGCTCTCAGC No data
Right 1148579519 17:48734129-48734151 CCGGAGCCTGCGCTTGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148579519 Original CRISPR CCGGAGCCTGCGCTTGGCAG GGG Intergenic
No off target data available for this crispr