ID: 1148580189

View in Genome Browser
Species Human (GRCh38)
Location 17:48738344-48738366
Sequence CAGGTTATTGAGAGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148580189_1148580208 22 Left 1148580189 17:48738344-48738366 CCCTCCACCCTCTCAATAACCTG No data
Right 1148580208 17:48738389-48738411 TCTCCAGCTGCCTTGGGTGGGGG No data
1148580189_1148580201 15 Left 1148580189 17:48738344-48738366 CCCTCCACCCTCTCAATAACCTG No data
Right 1148580201 17:48738382-48738404 GCCCAGATCTCCAGCTGCCTTGG No data
1148580189_1148580205 19 Left 1148580189 17:48738344-48738366 CCCTCCACCCTCTCAATAACCTG No data
Right 1148580205 17:48738386-48738408 AGATCTCCAGCTGCCTTGGGTGG No data
1148580189_1148580207 21 Left 1148580189 17:48738344-48738366 CCCTCCACCCTCTCAATAACCTG No data
Right 1148580207 17:48738388-48738410 ATCTCCAGCTGCCTTGGGTGGGG No data
1148580189_1148580203 16 Left 1148580189 17:48738344-48738366 CCCTCCACCCTCTCAATAACCTG No data
Right 1148580203 17:48738383-48738405 CCCAGATCTCCAGCTGCCTTGGG No data
1148580189_1148580206 20 Left 1148580189 17:48738344-48738366 CCCTCCACCCTCTCAATAACCTG No data
Right 1148580206 17:48738387-48738409 GATCTCCAGCTGCCTTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148580189 Original CRISPR CAGGTTATTGAGAGGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr