ID: 1148580414

View in Genome Browser
Species Human (GRCh38)
Location 17:48739420-48739442
Sequence CAGGCTGATCTGGAACTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85717
Summary {0: 72, 1: 2020, 2: 17718, 3: 34602, 4: 31305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148580414_1148580422 17 Left 1148580414 17:48739420-48739442 CCCAGGAGTTCCAGATCAGCCTG 0: 72
1: 2020
2: 17718
3: 34602
4: 31305
Right 1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG No data
1148580414_1148580421 13 Left 1148580414 17:48739420-48739442 CCCAGGAGTTCCAGATCAGCCTG 0: 72
1: 2020
2: 17718
3: 34602
4: 31305
Right 1148580421 17:48739456-48739478 ATTTCTGTTGAATCCGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148580414 Original CRISPR CAGGCTGATCTGGAACTCCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr