ID: 1148580414 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:48739420-48739442 |
| Sequence | CAGGCTGATCTGGAACTCCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 85717 | |||
| Summary | {0: 72, 1: 2020, 2: 17718, 3: 34602, 4: 31305} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1148580414_1148580422 | 17 | Left | 1148580414 | 17:48739420-48739442 | CCCAGGAGTTCCAGATCAGCCTG | 0: 72 1: 2020 2: 17718 3: 34602 4: 31305 |
||
| Right | 1148580422 | 17:48739460-48739482 | CTGTTGAATCCGAAGTTGGATGG | No data | ||||
| 1148580414_1148580421 | 13 | Left | 1148580414 | 17:48739420-48739442 | CCCAGGAGTTCCAGATCAGCCTG | 0: 72 1: 2020 2: 17718 3: 34602 4: 31305 |
||
| Right | 1148580421 | 17:48739456-48739478 | ATTTCTGTTGAATCCGAAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1148580414 | Original CRISPR | CAGGCTGATCTGGAACTCCT GGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||