ID: 1148580415

View in Genome Browser
Species Human (GRCh38)
Location 17:48739421-48739443
Sequence CCAGGCTGATCTGGAACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166449
Summary {0: 139, 1: 3788, 2: 36285, 3: 66516, 4: 59721}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148580415_1148580422 16 Left 1148580415 17:48739421-48739443 CCAGGAGTTCCAGATCAGCCTGG 0: 139
1: 3788
2: 36285
3: 66516
4: 59721
Right 1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG No data
1148580415_1148580421 12 Left 1148580415 17:48739421-48739443 CCAGGAGTTCCAGATCAGCCTGG 0: 139
1: 3788
2: 36285
3: 66516
4: 59721
Right 1148580421 17:48739456-48739478 ATTTCTGTTGAATCCGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148580415 Original CRISPR CCAGGCTGATCTGGAACTCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr