ID: 1148580418

View in Genome Browser
Species Human (GRCh38)
Location 17:48739439-48739461
Sequence AGAAATTCAGGGTTCAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148580418_1148580422 -2 Left 1148580418 17:48739439-48739461 CCTGGCTTGAACCCTGAATTTCT No data
Right 1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG No data
1148580418_1148580421 -6 Left 1148580418 17:48739439-48739461 CCTGGCTTGAACCCTGAATTTCT No data
Right 1148580421 17:48739456-48739478 ATTTCTGTTGAATCCGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148580418 Original CRISPR AGAAATTCAGGGTTCAAGCC AGG (reversed) Intergenic
No off target data available for this crispr