ID: 1148580422

View in Genome Browser
Species Human (GRCh38)
Location 17:48739460-48739482
Sequence CTGTTGAATCCGAAGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148580418_1148580422 -2 Left 1148580418 17:48739439-48739461 CCTGGCTTGAACCCTGAATTTCT No data
Right 1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG No data
1148580414_1148580422 17 Left 1148580414 17:48739420-48739442 CCCAGGAGTTCCAGATCAGCCTG 0: 72
1: 2020
2: 17718
3: 34602
4: 31305
Right 1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG No data
1148580415_1148580422 16 Left 1148580415 17:48739421-48739443 CCAGGAGTTCCAGATCAGCCTGG 0: 139
1: 3788
2: 36285
3: 66516
4: 59721
Right 1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG No data
1148580417_1148580422 7 Left 1148580417 17:48739430-48739452 CCAGATCAGCCTGGCTTGAACCC No data
Right 1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148580422 Original CRISPR CTGTTGAATCCGAAGTTGGA TGG Intergenic
No off target data available for this crispr