ID: 1148581022

View in Genome Browser
Species Human (GRCh38)
Location 17:48743811-48743833
Sequence TCAGCTTAGAAGGGTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148581022_1148581025 8 Left 1148581022 17:48743811-48743833 CCTGCTTTACCCTTCTAAGCTGA No data
Right 1148581025 17:48743842-48743864 TTGCCCAAAACTTTGTTCTCTGG No data
1148581022_1148581029 15 Left 1148581022 17:48743811-48743833 CCTGCTTTACCCTTCTAAGCTGA No data
Right 1148581029 17:48743849-48743871 AAACTTTGTTCTCTGGGACCTGG No data
1148581022_1148581031 23 Left 1148581022 17:48743811-48743833 CCTGCTTTACCCTTCTAAGCTGA No data
Right 1148581031 17:48743857-48743879 TTCTCTGGGACCTGGTGAGAGGG No data
1148581022_1148581030 22 Left 1148581022 17:48743811-48743833 CCTGCTTTACCCTTCTAAGCTGA No data
Right 1148581030 17:48743856-48743878 GTTCTCTGGGACCTGGTGAGAGG No data
1148581022_1148581026 9 Left 1148581022 17:48743811-48743833 CCTGCTTTACCCTTCTAAGCTGA No data
Right 1148581026 17:48743843-48743865 TGCCCAAAACTTTGTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148581022 Original CRISPR TCAGCTTAGAAGGGTAAAGC AGG (reversed) Intergenic
No off target data available for this crispr