ID: 1148584694

View in Genome Browser
Species Human (GRCh38)
Location 17:48769087-48769109
Sequence TACAAGGCCTTGGATCCAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148584690_1148584694 1 Left 1148584690 17:48769063-48769085 CCCTCATAGCACTTGCGTGGCTT 0: 1
1: 0
2: 0
3: 10
4: 70
Right 1148584694 17:48769087-48769109 TACAAGGCCTTGGATCCAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 116
1148584688_1148584694 16 Left 1148584688 17:48769048-48769070 CCTGCATACATGGGTCCCTCATA 0: 1
1: 0
2: 0
3: 9
4: 68
Right 1148584694 17:48769087-48769109 TACAAGGCCTTGGATCCAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 116
1148584691_1148584694 0 Left 1148584691 17:48769064-48769086 CCTCATAGCACTTGCGTGGCTTC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1148584694 17:48769087-48769109 TACAAGGCCTTGGATCCAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148584694 Original CRISPR TACAAGGCCTTGGATCCAGT TGG Exonic
903928749 1:26850166-26850188 TCCAAGGCCTGGGAGCCAGCTGG + Intronic
909488149 1:76197303-76197325 CACAAAGCCTTGCATACAGTTGG - Intronic
910028831 1:82690523-82690545 TACAAGGGCACAGATCCAGTGGG - Intergenic
910494452 1:87810879-87810901 TACAAGTTCTTGGATGCATTTGG + Intergenic
913032545 1:114924194-114924216 TAAAAGGCATTGGAATCAGTTGG + Intronic
915294691 1:154911775-154911797 GCCAAGGACTTGGATCCATTTGG - Intergenic
917861714 1:179151979-179152001 TAGAAGACTTTGAATCCAGTAGG - Intronic
919556743 1:199065060-199065082 CAGAAGGCCTTAGATCCAATAGG + Intergenic
922132220 1:222791054-222791076 TACCAGCACTTGGTTCCAGTTGG - Intergenic
922459300 1:225802747-225802769 GAAGAGGCCTTGGAACCAGTTGG + Intergenic
1063141394 10:3259404-3259426 TACATAGCTTGGGATCCAGTCGG - Intergenic
1070736438 10:78866664-78866686 CATAAGGCCTTGAACCCAGTAGG + Intergenic
1071376309 10:85008595-85008617 TACAATCCCTTGGAGCCAGAAGG - Intergenic
1071436842 10:85655290-85655312 CACAGGGACTTGGATCCAGTGGG - Intronic
1074404910 10:113172563-113172585 CACAAGGCCGTGGATCAAATTGG - Intergenic
1078717422 11:13853470-13853492 AACAATGCCTGGCATCCAGTAGG + Intergenic
1081267917 11:41049605-41049627 AATAATGGCTTGGATCCAGTGGG + Intronic
1085239332 11:75039487-75039509 CACTAGGCCTTTGATCCATTTGG + Intergenic
1087292765 11:96338587-96338609 TACAATGCCTTGAAGACAGTGGG - Intronic
1087507359 11:99042732-99042754 TACAATGCCTGGAATTCAGTGGG + Intronic
1088603531 11:111506507-111506529 TATTAGGCATTGTATCCAGTAGG - Intronic
1088895217 11:114073240-114073262 TACTAGTCCTTGGATCCATGCGG - Intronic
1090392977 11:126401485-126401507 TACAAGGCAGAGGTTCCAGTGGG + Intronic
1095425456 12:42070036-42070058 TACATGGTCTGGGGTCCAGTGGG + Intergenic
1098422894 12:70322451-70322473 TACAAGGTCCTAGATCCTGTTGG - Intronic
1101564900 12:105895867-105895889 TACAGGGGCTGTGATCCAGTAGG - Intergenic
1106117673 13:26831128-26831150 CACAAGGCATTGTTTCCAGTGGG + Intergenic
1107963773 13:45581028-45581050 TACATGGCCTTGGAGCCACTTGG - Intronic
1111417393 13:87967359-87967381 TACAAGGACTTGGAACTTGTTGG - Intergenic
1114842179 14:26277564-26277586 TAGCAGGCCAAGGATCCAGTAGG + Intergenic
1116187032 14:41610024-41610046 TACAAGGCCATGTATGCAGCGGG + Intronic
1120094513 14:80373813-80373835 TGCAAGGCCTTGGAACCGGGAGG + Intronic
1127616089 15:60687203-60687225 TAAAAGCCCTAGGATCCAATGGG + Intronic
1127667638 15:61164555-61164577 TACAAGCCCTTTGTTCCTGTTGG + Intronic
1131814426 15:96207482-96207504 CCCAAGGACTTGGATACAGTGGG - Intergenic
1131943171 15:97589822-97589844 TATAAGGCCCTGGATCTATTTGG + Intergenic
1133837187 16:9377644-9377666 TATAAGGCCTTTGCTTCAGTAGG - Intergenic
1137584733 16:49657576-49657598 TAAAAGGGCCTGGAGCCAGTGGG + Intronic
1138335300 16:56248374-56248396 TACATGGCTTTGGACACAGTAGG - Intronic
1141761436 16:86031220-86031242 TACAAAGCCTGGCATACAGTAGG - Intergenic
1148584694 17:48769087-48769109 TACAAGGCCTTGGATCCAGTTGG + Exonic
1150300060 17:64040306-64040328 CACAAGGCCAAGGATCCAATGGG + Exonic
1155253528 18:23973677-23973699 TACAAGGACATGGATGGAGTTGG - Intergenic
1155443955 18:25891304-25891326 TCCAAGGTCTTGTATCTAGTGGG - Intergenic
1156191761 18:34728605-34728627 AACAAGGACTTGGGTACAGTTGG + Intronic
1157958184 18:52122620-52122642 TACAAGGTATAGGTTCCAGTTGG + Intergenic
1162051384 19:8035942-8035964 GACAATCCCTTGGATCCAGGAGG + Intronic
1165428533 19:35758566-35758588 TACAAGCCCCAGGATCCACTGGG - Intronic
1165860102 19:38904918-38904940 CACAAGGCCTAGCATACAGTAGG + Intronic
1166562245 19:43740700-43740722 TCCAATGCCTGGGATCTAGTAGG - Intronic
1166960491 19:46493607-46493629 CGCGCGGCCTTGGATCCAGTGGG + Exonic
1168281159 19:55306095-55306117 TACAAGTCCTTGCAGGCAGTGGG + Intronic
1168378769 19:55902482-55902504 TCCAAGGCTCTGGAGCCAGTTGG + Intronic
925467508 2:4121011-4121033 TCCAAGGCCTTGGTTCCTCTAGG - Intergenic
930852360 2:55974536-55974558 TAAAAGGCCATGGATCCCTTTGG + Intergenic
931757651 2:65388439-65388461 TTCAAGGCCCAGGATCAAGTAGG - Intronic
943753204 2:191531534-191531556 TACAGGGCCCTGGATATAGTAGG + Intergenic
944124095 2:196274020-196274042 TACCAGGACATGGTTCCAGTGGG - Exonic
944541555 2:200758278-200758300 TACTAGGATTTGGATTCAGTGGG - Intergenic
945552784 2:211241685-211241707 AAGAATCCCTTGGATCCAGTAGG - Intergenic
948305525 2:236944402-236944424 TACAGGGCCCTGGCTCCAGTGGG + Intergenic
1172972380 20:38883021-38883043 TGCAATGCCTTGGAGGCAGTGGG + Intronic
1175281333 20:57806136-57806158 TACAAGTCCTAGGATTCACTTGG + Intergenic
1180604504 22:17046855-17046877 TACAAGGCCTTGCATATAGAAGG - Intergenic
1181952268 22:26563182-26563204 AACAAGGCCTGGCACCCAGTAGG - Intronic
1183581069 22:38727068-38727090 TAGAAGGCCTGTGGTCCAGTTGG + Intronic
949242607 3:1890079-1890101 TAGAAGGCCTTGGGTCCTGAGGG - Intergenic
949412238 3:3778492-3778514 TAGAAGGCATAGGATCAAGTGGG + Intronic
952141660 3:30485941-30485963 TACAAGGCCATGCATTTAGTAGG + Intergenic
952514761 3:34092656-34092678 TACCAGGCATTGGAGGCAGTAGG - Intergenic
953540558 3:43814193-43814215 GACAACGCCTTGGAACCAGAGGG + Intergenic
955066743 3:55539999-55540021 TATAAGGCATGGGATCCAGTTGG - Intronic
965304589 3:167048060-167048082 GACAGGGCCTTAGATACAGTAGG + Intergenic
967403674 3:189092822-189092844 AACAGGGCCTTGCATGCAGTAGG - Intronic
968425289 4:519236-519258 TGCTGGGGCTTGGATCCAGTAGG - Intronic
970359823 4:15297784-15297806 AACAAGGCCTTATATCTAGTAGG + Intergenic
974248101 4:59348985-59349007 TTGAAGGCCTTGGAACCAGGAGG + Intergenic
976929783 4:90551756-90551778 TACAAGGCTTAGGGTCTAGTGGG - Intronic
978402556 4:108346224-108346246 TCAAAGGCCTTGTTTCCAGTAGG + Intergenic
979653746 4:123167144-123167166 TATAAGGCCCTGAAACCAGTTGG - Intronic
980173048 4:129312460-129312482 GACAGGACCTAGGATCCAGTTGG - Intergenic
981197054 4:141933956-141933978 TTCAAGTGTTTGGATCCAGTAGG - Intergenic
983185352 4:164694427-164694449 TACATGGCCATGGATGAAGTAGG + Intergenic
983485459 4:168327372-168327394 ATCAAGACTTTGGATCCAGTTGG - Intergenic
984097452 4:175449878-175449900 TTAAAGGCCTTAGTTCCAGTAGG + Intergenic
984753386 4:183300215-183300237 TACGAGGCCTGGGAGCCACTTGG - Intronic
991547013 5:67793671-67793693 TACAAGGCCTTGGCTTCAAAAGG - Intergenic
997660003 5:135582237-135582259 TACAACGCCTGGGACACAGTGGG - Intergenic
999082185 5:148855125-148855147 TAGAAGGCCCTGGACGCAGTGGG + Intergenic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
999916409 5:156267487-156267509 TAGAAAGCCTTGGATCCGGCAGG - Intronic
1001796030 5:174503273-174503295 TGCAATGCCTGGTATCCAGTAGG + Intergenic
1002080627 5:176735192-176735214 AACAAGCCCCTGGATCCAGCTGG + Intergenic
1002838425 6:885101-885123 CACAAGGCCTGGGGTCCTGTTGG - Intergenic
1007248515 6:40479765-40479787 TACAAGGCATGGGCTCCATTTGG + Intronic
1008102306 6:47405018-47405040 TACAAGGCCTGGCACGCAGTAGG + Intergenic
1013610198 6:111787603-111787625 TACAGGGCCTGGTATGCAGTAGG + Intronic
1015433466 6:133157527-133157549 TACCAGTCTTTGGGTCCAGTAGG - Intergenic
1017681720 6:156871282-156871304 TACAGTGCCTGGCATCCAGTAGG + Intronic
1017828074 6:158097476-158097498 TACAAGGTCTGGAATCCATTTGG + Exonic
1019261566 7:84682-84704 GCCCAGGCCTTGGCTCCAGTGGG - Intergenic
1021870026 7:24996562-24996584 TACAGGGGCTTGGATGAAGTTGG - Intergenic
1027027956 7:74868103-74868125 TACAAGACCTTGTCTCCAGCCGG - Intergenic
1027059794 7:75075968-75075990 TACAAGACCTTGTCTCCAGCCGG + Intergenic
1029115843 7:98236664-98236686 GACAAGTCCTGGGACCCAGTGGG + Intronic
1032131246 7:129230023-129230045 TACAATGCCTGGTATACAGTAGG - Intronic
1033762966 7:144456550-144456572 TGCAAGGCCTTGGATGCTTTTGG + Intronic
1037583273 8:20259288-20259310 TACAAGGCCTGGCATGTAGTAGG + Intronic
1041770960 8:61471976-61471998 TACAAGCCCTGGGATGCAGAAGG - Intronic
1041798855 8:61775892-61775914 TACAATGCCTTGCATACAGCAGG - Intergenic
1045939274 8:107719061-107719083 TACAATGCCTGGCATCCAATAGG + Intergenic
1047362806 8:124184460-124184482 CCCAAGGCCTTGGCTCCTGTTGG + Intergenic
1047370291 8:124250617-124250639 TCAAAGACCTTGCATCCAGTGGG + Intergenic
1058836443 9:108862262-108862284 TTTCAGGCCTTGAATCCAGTGGG + Exonic
1060287587 9:122267445-122267467 TACAATGCCTGGCATCCAGTAGG - Intronic
1061352285 9:130074923-130074945 TACAATGCCTGGCATCTAGTAGG - Intronic
1061597907 9:131644213-131644235 TGGGAGGCCTTGGATCCAGTTGG + Intronic
1062050420 9:134444112-134444134 TCCAGGGCCTGGGATCCAGGAGG + Intergenic
1062240738 9:135536443-135536465 CCCAAAGCCTTGGTTCCAGTGGG + Intergenic
1187503499 X:19859674-19859696 TCAAAGGCCTAGGAACCAGTAGG - Intronic
1191235271 X:58129029-58129051 TAGAAGGCCTGGGATCAATTAGG - Intergenic
1196687898 X:118528211-118528233 TACAAGCCCTGGGATCAACTGGG - Intronic
1198442301 X:136675002-136675024 AACAAGGCCATGGCTCAAGTAGG - Exonic