ID: 1148586995

View in Genome Browser
Species Human (GRCh38)
Location 17:48788011-48788033
Sequence CAGAACATGGGGCTGCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 234}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148586987_1148586995 5 Left 1148586987 17:48787983-48788005 CCTTGGCTTCCTCAATCCTGTTG 0: 1
1: 0
2: 1
3: 58
4: 469
Right 1148586995 17:48788011-48788033 CAGAACATGGGGCTGCTGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 234
1148586984_1148586995 14 Left 1148586984 17:48787974-48787996 CCCGGAAACCCTTGGCTTCCTCA 0: 1
1: 0
2: 1
3: 35
4: 305
Right 1148586995 17:48788011-48788033 CAGAACATGGGGCTGCTGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 234
1148586990_1148586995 -4 Left 1148586990 17:48787992-48788014 CCTCAATCCTGTTGGGAAGCAGA 0: 1
1: 0
2: 2
3: 19
4: 174
Right 1148586995 17:48788011-48788033 CAGAACATGGGGCTGCTGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 234
1148586985_1148586995 13 Left 1148586985 17:48787975-48787997 CCGGAAACCCTTGGCTTCCTCAA 0: 1
1: 0
2: 0
3: 25
4: 178
Right 1148586995 17:48788011-48788033 CAGAACATGGGGCTGCTGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 234
1148586986_1148586995 6 Left 1148586986 17:48787982-48788004 CCCTTGGCTTCCTCAATCCTGTT 0: 1
1: 0
2: 0
3: 26
4: 334
Right 1148586995 17:48788011-48788033 CAGAACATGGGGCTGCTGTCAGG 0: 1
1: 0
2: 0
3: 22
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148586995 Original CRISPR CAGAACATGGGGCTGCTGTC AGG Intronic
900500846 1:3003788-3003810 CAGTGTATGGGGCTGCCGTCGGG + Intergenic
901564865 1:10105686-10105708 CAGAACATGGGGCTTGTTCCTGG - Exonic
902182777 1:14702062-14702084 GAGTACATGGGTCTGCTTTCTGG + Intronic
902386389 1:16078278-16078300 CAGGACTGGGGGCTGCTGGCTGG + Intergenic
903178954 1:21595980-21596002 AAGAACATGGCTGTGCTGTCAGG - Intergenic
903180381 1:21602226-21602248 CATGGCATGGGGCTGCTGTGGGG - Intronic
903934447 1:26885508-26885530 CAGGACCAGGGGCTGCTGTAGGG - Intronic
904849644 1:33447669-33447691 CAGAACCTGGGGCCGGTGACAGG + Intergenic
905277334 1:36826969-36826991 CAGAACATGGGGCTGAAGGAGGG - Intronic
905931321 1:41789812-41789834 CAGGGCATGGGGCAACTGTCTGG - Intronic
906111122 1:43322736-43322758 CAGAACGTGGCTCTGCTGGCCGG + Exonic
908582473 1:65530457-65530479 CAGACCTTGGGGCTGCTCTATGG - Intronic
909548003 1:76868486-76868508 CAGACCATGGCGCTGCGGGCGGG - Exonic
910796154 1:91099675-91099697 CAGCCCATGGGGCTGCTCTATGG - Intergenic
911423850 1:97681105-97681127 CACTTCATGGGGCTGCTGTGGGG - Intronic
917536387 1:175877444-175877466 CAGGGCATGGGGCTGCTCACTGG + Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919793271 1:201305924-201305946 CAGAACATGGAGCTCCTGGAGGG + Intronic
921545021 1:216464145-216464167 CAAAAGATGTGACTGCTGTCTGG - Intergenic
921954303 1:220966281-220966303 CAGCATATGGAGCTGCTCTCAGG + Intergenic
924805916 1:247361542-247361564 CTGCAAATGGGGCTACTGTCTGG + Intergenic
1063082761 10:2783828-2783850 CAGACCCTGGGGATGCTTTCTGG - Intergenic
1063505489 10:6594416-6594438 CAGAACGTCGGGTTGCTGGCTGG + Intergenic
1063864294 10:10347099-10347121 CTGGCCATGGGGCTGCCGTCAGG + Intergenic
1064404774 10:15051984-15052006 CAGAATATGTGGCTGCAGGCTGG + Intronic
1068449968 10:57173628-57173650 TATAACATGGAGCTGTTGTCTGG - Intergenic
1069953261 10:72034201-72034223 CGGATGATCGGGCTGCTGTCTGG - Intergenic
1069956430 10:72054646-72054668 CAGAACCTGGGGCTGGTGACGGG + Intergenic
1073125314 10:101145666-101145688 CAGGACATCAGGCTGCTGTGTGG - Intergenic
1075016229 10:118911822-118911844 CAGCACATGGTTCTGCTGCCAGG - Intergenic
1075606775 10:123817312-123817334 CAGAAGATAGGCATGCTGTCTGG + Intronic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1076591579 10:131587248-131587270 CAGACCATGGGGATGTGGTCAGG + Intergenic
1076790335 10:132773832-132773854 CAGAAGATGGGGCTGCAGTGAGG - Intronic
1078098417 11:8314229-8314251 CAGGCCATGAGGCTGCTGGCAGG + Intergenic
1083743779 11:64724015-64724037 CAGAGAAGGGGGCTGCTGCCAGG - Intergenic
1084656340 11:70521845-70521867 GAGGACATGTGGCTGCAGTCAGG - Intronic
1088375374 11:109134972-109134994 CAGAACATGGGTGTTCTGTAGGG + Intergenic
1089148937 11:116349934-116349956 CAGCTCATGGGGCTGGGGTCTGG + Intergenic
1089641804 11:119852796-119852818 CAGGACAGAGGGCTGGTGTCAGG + Intergenic
1090413093 11:126522458-126522480 CAGGACCTGGGGCTTCTGGCGGG - Intronic
1091815468 12:3434624-3434646 CAGAAAATGGAGCTGATGACAGG + Intronic
1098886556 12:75966666-75966688 CTGCACATAGGGCTGCTGTCAGG - Intergenic
1099455464 12:82857424-82857446 CAGAACCTGGGGCTGGTTCCTGG + Exonic
1101568523 12:105932323-105932345 GAGAACATTGTGCTCCTGTCTGG + Intergenic
1102413733 12:112742628-112742650 AGGATCCTGGGGCTGCTGTCAGG + Intronic
1102568308 12:113811683-113811705 CAGCACAGCGGGGTGCTGTCTGG + Intergenic
1102957502 12:117068618-117068640 CAGAACATGGGGCTGCACGTTGG + Intronic
1103917347 12:124382748-124382770 CTGAATATGGGGCTGCTGAATGG + Intronic
1106862019 13:33920165-33920187 CATAACATGGGGATGCTGTAAGG - Intronic
1107104317 13:36626918-36626940 CAGCCCTTGGGGCTGCTGTATGG + Intergenic
1111060735 13:83015721-83015743 CAGAAGTTGAGGCTGCAGTCAGG + Intergenic
1112650294 13:101389470-101389492 CTAAACATGGGGCTGTGGTCTGG - Intronic
1113146315 13:107211973-107211995 CAGAACATGGGTTTGAAGTCTGG - Intronic
1113481664 13:110626097-110626119 CAGGGTGTGGGGCTGCTGTCAGG + Intronic
1113556832 13:111242728-111242750 GAGGACCTGGGGCCGCTGTCTGG + Intronic
1113586170 13:111467661-111467683 CAAACCATGGAGCTCCTGTCAGG - Intergenic
1116313827 14:43360597-43360619 CAGAACCTGCTGCTGCTGCCTGG - Intergenic
1117444472 14:55790364-55790386 AAGAACAAGGGGCTGCCCTCTGG - Intergenic
1117833861 14:59781536-59781558 CAGAACATGGGGCTGGGTTTTGG - Intronic
1118487949 14:66231965-66231987 CAGAATATGGGGCTTCCCTCTGG - Intergenic
1118835123 14:69472437-69472459 CAGAACATGGGGGTGGGGACAGG - Intergenic
1119946035 14:78695475-78695497 AAAAGCCTGGGGCTGCTGTCAGG + Intronic
1120704542 14:87733622-87733644 CATAACCTGAGGCTGCTGACAGG + Intergenic
1120722292 14:87902222-87902244 CAGAAGATGTGGCTGCTGTGTGG - Intronic
1121684811 14:95827884-95827906 CAGAAAATGGAGCTGGTGACTGG + Intergenic
1122971770 14:105155111-105155133 CAGAGGAAGGGGCTGCTGGCAGG - Intronic
1123986719 15:25652827-25652849 CAGAGCCTGGAGCAGCTGTCTGG + Intergenic
1124097813 15:26665599-26665621 CAGAAAAAGGAGCTGGTGTCAGG + Intronic
1125170156 15:36757663-36757685 CAGAAGATGTGGCTGCTAACAGG - Intronic
1125538335 15:40455611-40455633 CAGCACAGGGAGGTGCTGTCAGG - Intronic
1125617074 15:41024362-41024384 CAGAATAGGGGGAGGCTGTCTGG - Intronic
1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG + Intergenic
1127392346 15:58516485-58516507 CAGAACATCAGGGAGCTGTCGGG - Intronic
1128454986 15:67827188-67827210 CAGAACATGGCGCCGCCGCCCGG - Intronic
1129056584 15:72824542-72824564 CAAACCATGAGGCTGCTCTCTGG - Intergenic
1129603974 15:77015863-77015885 CAGAGCTTTGGGCTGCTGGCAGG - Intronic
1129873176 15:78954767-78954789 CAGAGCAAGGGTCTCCTGTCAGG - Intergenic
1130095265 15:80850953-80850975 CAGCTGATGGGGCTGCTGACTGG + Intronic
1133283011 16:4677650-4677672 GAGAACACGGGGCTGCTGGCTGG - Intronic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1135739601 16:24962470-24962492 CAAAACATAGGCCTGCTTTCAGG + Intronic
1136382728 16:29903688-29903710 CAGCACATGTGGCATCTGTCAGG - Intronic
1137615757 16:49845932-49845954 CAGGACATGGGGCTGCTGGAGGG + Intronic
1139273669 16:65706770-65706792 CTGATCATGAGGCTGCTTTCAGG - Intergenic
1140111405 16:72008599-72008621 CAGAACCTGGGGGTGGTGCCGGG + Intronic
1140567076 16:76056004-76056026 CACACCATGTGGCTGCTGCCAGG + Intergenic
1141426521 16:83947779-83947801 CAGCACCAGGGGCTGCTGTGTGG + Intronic
1141690801 16:85595179-85595201 CAGCACATGGTCCTGCTCTCTGG + Intergenic
1142195573 16:88737875-88737897 CAGGCCATGGGGCTGGTCTCAGG - Intronic
1142574071 17:894681-894703 CAGAACCTGGGGGTCCTGCCGGG + Intronic
1144457300 17:15429715-15429737 CAGAGCAGGGGGCTTTTGTCTGG - Intergenic
1144619688 17:16809545-16809567 CAGAACATGGGTTTGAGGTCAGG + Intergenic
1144769809 17:17753171-17753193 CAGCCCCTGGGGCTCCTGTCTGG - Intronic
1144892997 17:18506159-18506181 CAGAACATGGGTTTGAGGTCAGG - Intergenic
1144970149 17:19103559-19103581 CAGAAAATGGGGTTACTATCAGG + Intergenic
1144990454 17:19229726-19229748 CAGAAAATGGGGTTACTATCAGG + Intronic
1145139220 17:20438133-20438155 CAGAACATGGGTTTGAGGTCAGG + Intergenic
1145275549 17:21427176-21427198 GAGAACATGGGGCGGGTGACTGG + Intergenic
1145313398 17:21713070-21713092 GAGAACATGGGGCAGGTGACTGG + Intergenic
1145711849 17:26985026-26985048 GAGAACATGGGGCGGGTGGCTGG + Intergenic
1147169399 17:38609258-38609280 CGGTCCATGGGGCTGTTGTCTGG + Intergenic
1148230560 17:45930921-45930943 CAGAAGATGGTGCTCCTGGCAGG - Intronic
1148586995 17:48788011-48788033 CAGAACATGGGGCTGCTGTCAGG + Intronic
1152259688 17:79260292-79260314 CGGCACATGGGGCTGCTTTGTGG - Intronic
1152290235 17:79436202-79436224 CAGGACATGGGGCTGCCCACAGG + Intronic
1153008822 18:519429-519451 AGGAACATGGGGCTGCTGGCAGG - Intergenic
1154020779 18:10662521-10662543 TAGAACCTGGGGCTGCTCTCAGG + Intergenic
1158597464 18:58828589-58828611 CATCACATGGAGCTGCTGGCTGG - Intergenic
1158664587 18:59420954-59420976 AAGAACATGGGGATGCTGGCTGG + Intergenic
1159973205 18:74678430-74678452 CAGAAAATGGGGTTGCAGGCAGG - Intronic
1160796622 19:948579-948601 CAGAGCCTGGGGCTGCAGGCGGG - Intronic
1161066940 19:2243324-2243346 CAGAACTCGGGGCTGCTGCTGGG - Intronic
1162477207 19:10907795-10907817 CTGCATGTGGGGCTGCTGTCTGG - Intronic
1162858362 19:13487242-13487264 CAGAACATGGACCTGCTGCTGGG + Intronic
1163263764 19:16206289-16206311 CAGAGGCTGGGGCTGCTGCCTGG - Intronic
1163478793 19:17542436-17542458 CACCACATGTGGCTGCTGCCTGG - Intronic
1165815981 19:38642488-38642510 TAGGACATCGGGCTGCTGCCTGG + Intergenic
1165959942 19:39525415-39525437 CAGAGCTTGTGGCTGGTGTCTGG + Intergenic
1166760487 19:45221173-45221195 AAGAAAACTGGGCTGCTGTCAGG - Intronic
1168618616 19:57858421-57858443 TTGAAGATGGGGCTGCTGGCTGG - Intronic
1168624888 19:57910247-57910269 TTGAAGATGGGGCTGCTGGCCGG + Intronic
925178359 2:1800457-1800479 CAGGCCATGTGGCTGCTGCCTGG - Intronic
925269464 2:2591973-2591995 CAGAACATAAGGCTTCTCTCTGG - Intergenic
927213635 2:20653541-20653563 CAGAAAATGGGATTGCTGTTGGG - Intergenic
927801400 2:26103165-26103187 CAGAACATGGGTTTGGGGTCAGG - Intronic
930971996 2:57407786-57407808 CACAGCATGTGGCTGCTGCCAGG - Intergenic
931319674 2:61163944-61163966 TAGCACAGGGGGCTGCGGTCTGG - Intronic
935658211 2:105443001-105443023 CAGGACTTGGGGCTGTGGTCAGG + Intergenic
936060990 2:109295649-109295671 CAGGACAGGGGCCTGCTGCCTGG + Intronic
937332620 2:121041760-121041782 CAGCACATGAGGCTGCTGCTGGG - Intergenic
937908690 2:127064990-127065012 GAGAACGTGAGGCTGCTGGCGGG - Intronic
938314191 2:130315049-130315071 CAGAACCTGGGGGTGGGGTCAGG + Intergenic
938337950 2:130515770-130515792 CAGAACATTGGTGTGCAGTCTGG + Intergenic
938351889 2:130604968-130604990 CAGAACATTGGTGTGCAGTCTGG - Intergenic
941650889 2:168091465-168091487 CAGGACTTGGGGCAGCTTTCTGG - Intronic
941856188 2:170233643-170233665 CAGAAGATGGGGCTGGGGCCAGG + Intronic
941929127 2:170923654-170923676 CATCGCATGGGGCAGCTGTCTGG + Intergenic
943697288 2:190950177-190950199 CAGAACATCTGGCTGGTCTCAGG - Intronic
946167762 2:217875855-217875877 CAGAACCGGGGGCTGGTGACAGG - Intronic
948244958 2:236473247-236473269 CAGAACATGGGGTTCCTCTTTGG - Intronic
1170798776 20:19572808-19572830 CTGACCATGGGTCTGCTGTAGGG - Intronic
1174186541 20:48710127-48710149 CAGGATATGGTGCTGCTCTCTGG - Intronic
1177275446 21:18907067-18907089 TAGAACATCAGGCTGCTGTATGG - Intergenic
1178704740 21:34864099-34864121 CAGAGCATGTGGCTCCTGTCAGG - Intronic
1181048733 22:20228772-20228794 CAGCAAATGGTGCTGTTGTCAGG - Intergenic
1181888185 22:26038220-26038242 CAGAACTTGGAGGTGCTGTCAGG - Intergenic
1183306121 22:37084146-37084168 CAGAGGCTGGGGCTGGTGTCAGG - Intronic
1185317191 22:50184310-50184332 CAGAACCTGGGGCTGGGGCCGGG + Intergenic
954644576 3:52123100-52123122 CATCTCATGGGGCTGCTGTGAGG + Intronic
955074291 3:55598768-55598790 AGGAAGATGGGGCTGCTGTAGGG + Intronic
955843167 3:63133225-63133247 CAGGGCATGGGGCTGTTGCCAGG - Intergenic
956233091 3:67039337-67039359 CAGAACTTGGGTCTGCCCTCAGG - Intergenic
961125283 3:124412109-124412131 CCTCACAAGGGGCTGCTGTCTGG - Intronic
961492300 3:127264324-127264346 CAGCTCATGGGGCTGAAGTCTGG + Intergenic
961569591 3:127788288-127788310 CACATCATGGGGGTGCTGTGAGG - Intronic
962252868 3:133848557-133848579 AAGAACATGGCACTGGTGTCTGG + Intronic
962463772 3:135638378-135638400 CTGAAGGTGGGGCTGCTGCCAGG + Intergenic
962532694 3:136298131-136298153 CAGACCCTGGGGGTCCTGTCAGG - Intronic
962848975 3:139293808-139293830 CACAACATGGGGTTGTTATCAGG + Intronic
963009799 3:140758612-140758634 CAGGAAATGGGGCTGGTGCCAGG + Intergenic
965648335 3:170908318-170908340 CAGAACAGGGGGCGCCTGTGCGG - Intronic
966294342 3:178401712-178401734 CAGAGGATGGGGCTGCTGGAGGG + Intergenic
967282730 3:187837637-187837659 CAGAGAAAGGGGCTGCTTTCTGG - Intergenic
969603138 4:8188810-8188832 CCCAACAAGGGGCTGCTGCCTGG + Intronic
969635038 4:8363962-8363984 CAGCCCTTGGGGCTGCTGTATGG + Intergenic
970401239 4:15719761-15719783 CAGCCCATGGGGCTGCTGGAAGG - Intronic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
972165754 4:36281973-36281995 CAGCACATGCAGCTGCTGGCAGG - Intronic
972631775 4:40848418-40848440 CAGAACACAGGCCTGCTGGCTGG + Intronic
974251813 4:59394586-59394608 CACAAAATGGGGCAGCTGTTTGG - Intergenic
975684481 4:76906121-76906143 CAGACCATCTGGCTGCTGTGTGG + Intergenic
976678375 4:87727901-87727923 AAGAGCATGGTGCTGGTGTCTGG + Intergenic
980119532 4:128713666-128713688 CAGAACATGGTGCTGGCATCTGG + Intergenic
982343438 4:154330136-154330158 CTGAGCCTGGGACTGCTGTCAGG + Intronic
985658327 5:1143351-1143373 CAGACCAAGGGGCTGCTGGGCGG + Intergenic
986548362 5:8924523-8924545 CAGAGCAGTGGGCTCCTGTCTGG - Intergenic
986826523 5:11528575-11528597 CAGAGTCTGGGGCTGGTGTCAGG + Intronic
988310984 5:29556777-29556799 CAGAAGATGTGGCTGTTCTCTGG + Intergenic
992833775 5:80620555-80620577 GTGAACATGGGCCTGCTCTCTGG + Intergenic
995256860 5:110056818-110056840 CAGAAAAGGGGGCTGATGTGGGG - Intergenic
997691891 5:135832840-135832862 AAGAAAATGGGGTTGCTTTCTGG + Intergenic
999441655 5:151605953-151605975 CAGAACAAGGCTCTCCTGTCTGG - Intergenic
999456240 5:151718765-151718787 CAGTGTCTGGGGCTGCTGTCTGG + Intergenic
999615848 5:153422939-153422961 AAGAAAATGGGACTGCTGACTGG + Intergenic
1000036549 5:157452884-157452906 CCTAACATGGGGTTGCTGTAAGG + Intronic
1001950099 5:175810332-175810354 CAGACCTTCTGGCTGCTGTCTGG + Intronic
1002211309 5:177600814-177600836 CAGAGCACGGAGCTTCTGTCTGG - Intronic
1002398443 5:178976210-178976232 CAGAGAATGGGGCAGCTGGCGGG - Intergenic
1003826265 6:9955807-9955829 CAGAACATTGCTCTGCTGCCCGG + Intronic
1005097912 6:22138634-22138656 CAGAAGATGGCGCTGAGGTCAGG + Intergenic
1006094856 6:31649464-31649486 CAGAGGTTGGGGCTACTGTCTGG - Intronic
1006790654 6:36698982-36699004 CAGGCCGTGGGGGTGCTGTCAGG + Intronic
1006934430 6:37707497-37707519 CACAAAATGGAGCTTCTGTCAGG + Intergenic
1008584002 6:52932678-52932700 CAGATCCTGGGGATGCTGTGAGG + Intergenic
1011359826 6:86511423-86511445 CACAGCATAGGGCTGCTGCCTGG + Intergenic
1011478383 6:87769967-87769989 CAGCACATGCGTCTGCTTTCTGG - Intergenic
1013491005 6:110646385-110646407 CTGCCCATGGGGCTGCTGGCGGG + Intronic
1013804781 6:113985109-113985131 CAGAGCATGTGGCTGATGCCAGG - Intronic
1014017894 6:116554613-116554635 TACCACATGGGGCTGCTGTGGGG + Intronic
1014167785 6:118245477-118245499 CTGGACACGGAGCTGCTGTCTGG + Intronic
1014222247 6:118809476-118809498 CAGAACGTGGGGCTGCTGGGAGG + Intergenic
1017721445 6:157246082-157246104 GAGGAGATGGGGTTGCTGTCTGG - Intergenic
1018927467 6:168216410-168216432 CAAATGATGGGGCTGCTGTGAGG - Intergenic
1019520387 7:1458276-1458298 CAGCACCTGGGGCCTCTGTCAGG - Intronic
1019777072 7:2918251-2918273 CAGGACAAGGGGTTGGTGTCTGG - Intronic
1020213064 7:6169863-6169885 GAGCACATGGGGATGCTGTGTGG - Intronic
1021821793 7:24505951-24505973 CAGAGAATGGCTCTGCTGTCTGG - Intergenic
1023722502 7:43111435-43111457 CAGAAGATCTGACTGCTGTCAGG + Intergenic
1024270985 7:47641301-47641323 CAGAACCTTGGGCTGCTCTAAGG + Intergenic
1024841775 7:53595302-53595324 CAGCACAGGGGCCTGCTGTCTGG - Intergenic
1024905461 7:54374178-54374200 CTGACCCTGGGGCTGCTGACTGG + Intergenic
1025012183 7:55406380-55406402 CAGAAGATGGGGGAGCAGTCAGG + Intronic
1026008852 7:66621121-66621143 CAGAACATGGTGGTGCACTCCGG + Intergenic
1029244984 7:99192738-99192760 TAGATCATGTGGCTGCTGCCTGG - Intronic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1033283812 7:140024004-140024026 CAGAACAGGTGGCTGCTGTGTGG - Exonic
1034421837 7:150994773-150994795 TCACACATGGGGCTGCTGTCAGG + Intronic
1035587617 8:787837-787859 CAGCACTTGGGGCTGCTGTGAGG + Intergenic
1035987741 8:4453380-4453402 CAGAACTTGGTGCTGAAGTCAGG + Intronic
1037863007 8:22419621-22419643 CAGAACCTGGGCCTCCTGACTGG + Exonic
1037987946 8:23301331-23301353 CAGAACATGCCGCTGTTTTCAGG + Intronic
1038249565 8:25890485-25890507 CAGAACATGGGTTTGGAGTCAGG + Intronic
1038278754 8:26143602-26143624 AAGATCATGGTGCTGCTGCCTGG - Intergenic
1038590587 8:28833733-28833755 CAGAAGGTGTGGCTGCTGTGGGG + Intronic
1039418764 8:37418431-37418453 GTGAATATGGGGCAGCTGTCAGG + Intergenic
1042173377 8:66014625-66014647 TAGAAAAAGGGGCTGCTGTTTGG - Intergenic
1044297048 8:90540776-90540798 TGGATCATAGGGCTGCTGTCTGG + Intergenic
1047976418 8:130134946-130134968 CAGATGTTGGGGCTGCTCTCTGG + Intronic
1055645181 9:78356444-78356466 AGGGACATGGGCCTGCTGTCAGG - Intergenic
1056378487 9:86036384-86036406 CGGAACTGGGGGCTGGTGTCTGG + Exonic
1056967853 9:91179450-91179472 CACAGCATGGGGGTGCTGTGGGG - Intergenic
1057011234 9:91603614-91603636 CTGAACTTGTGGCTGCTGTCTGG - Intronic
1057200306 9:93136179-93136201 CAGCTCCTGGGGCTGCTGGCAGG + Intergenic
1057337856 9:94171169-94171191 CACCTCATGGGGTTGCTGTCAGG - Intergenic
1058196618 9:101984720-101984742 CAGAACATGTGACTGTTGTTAGG - Intergenic
1060522875 9:124303754-124303776 CAGGACATGGTGCTGATGGCTGG + Intronic
1060629646 9:125143793-125143815 GAGAACCTGGGGCAGGTGTCTGG - Intergenic
1060912744 9:127363666-127363688 CACAACATGGTGCTCCTGTGAGG + Intronic
1061005216 9:127925116-127925138 CGGAAGATGAGGCTGCTGCCCGG + Exonic
1061010177 9:127950099-127950121 CAGCTCGTGGGGCTGCTGTCAGG + Intronic
1061406817 9:130396846-130396868 CAGATCTAGGGGCTGCTCTCAGG + Intronic
1061707458 9:132463825-132463847 CTGTGCATGGGGCTGCTGACAGG + Intronic
1061911314 9:133726644-133726666 CAGAGCAGGAGGCTGCTGCCTGG - Intronic
1062278220 9:135740553-135740575 CAGAGCCTGGGGCTGGGGTCGGG - Intronic
1062525328 9:136975956-136975978 CAGAGCTGGGGGCTGCCGTCAGG - Intergenic
1186514209 X:10154066-10154088 CAGAACAGGAGGCTGATGTCAGG + Intergenic
1186773329 X:12839334-12839356 CTGAAAAGGGGGCTGCAGTCAGG - Intergenic
1188004109 X:25005604-25005626 CAGGATGTGGGGCTGCTGGCAGG - Intronic
1189647176 X:43145733-43145755 CAGAACATAGAGCTGCTTTCAGG - Intergenic
1190981944 X:55464021-55464043 CAGACGGTGGGGCTGCTGTGAGG - Intergenic
1190986754 X:55509159-55509181 CAGACGGTGGGGCTGCTGTGAGG + Intergenic
1191799955 X:65067224-65067246 CACAAAATGGGGCAGCTGTTTGG - Intergenic
1191802674 X:65098790-65098812 CACAAAATGGGGCAGCTGTTTGG + Intergenic
1198161267 X:134010970-134010992 CAGAGCAGGGGGCAGGTGTCTGG + Intergenic
1198582919 X:138086813-138086835 TATAAAATGGTGCTGCTGTCAGG + Intergenic
1199793660 X:151176644-151176666 CAGAACAGGTGTTTGCTGTCTGG + Exonic