ID: 1148587376

View in Genome Browser
Species Human (GRCh38)
Location 17:48790669-48790691
Sequence TTGTAGGTGTGGTGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 413}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148587376_1148587388 -2 Left 1148587376 17:48790669-48790691 CCCTCTTCCCACCACACCTACAA 0: 1
1: 0
2: 3
3: 50
4: 413
Right 1148587388 17:48790690-48790712 AAGGGCTGGGAATGGAAGAAGGG 0: 1
1: 0
2: 12
3: 134
4: 982
1148587376_1148587387 -3 Left 1148587376 17:48790669-48790691 CCCTCTTCCCACCACACCTACAA 0: 1
1: 0
2: 3
3: 50
4: 413
Right 1148587387 17:48790689-48790711 CAAGGGCTGGGAATGGAAGAAGG 0: 1
1: 0
2: 3
3: 103
4: 797
1148587376_1148587389 10 Left 1148587376 17:48790669-48790691 CCCTCTTCCCACCACACCTACAA 0: 1
1: 0
2: 3
3: 50
4: 413
Right 1148587389 17:48790702-48790724 TGGAAGAAGGGCAAAGCTGCAGG 0: 1
1: 0
2: 3
3: 33
4: 374
1148587376_1148587390 30 Left 1148587376 17:48790669-48790691 CCCTCTTCCCACCACACCTACAA 0: 1
1: 0
2: 3
3: 50
4: 413
Right 1148587390 17:48790722-48790744 AGGAATCTGACCTGTAATCTCGG 0: 1
1: 0
2: 1
3: 12
4: 166
1148587376_1148587385 -10 Left 1148587376 17:48790669-48790691 CCCTCTTCCCACCACACCTACAA 0: 1
1: 0
2: 3
3: 50
4: 413
Right 1148587385 17:48790682-48790704 ACACCTACAAGGGCTGGGAATGG 0: 1
1: 0
2: 1
3: 16
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148587376 Original CRISPR TTGTAGGTGTGGTGGGAAGA GGG (reversed) Intronic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
901065717 1:6493249-6493271 TTCTAGCTGTGCTGGGAGGAAGG - Intronic
901133655 1:6979078-6979100 TTGTTGGTGTGGCTGGAGGAGGG + Intronic
901151610 1:7107024-7107046 TGGCAGGTGGGGTGGGGAGAGGG + Intronic
902396083 1:16133066-16133088 GTGCAGGTGTGGGGGGAAGGTGG + Intronic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
902951950 1:19891596-19891618 TTGGAGGTGAGGAGGGGAGAGGG + Intronic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903231064 1:21922633-21922655 GTGGAGGTGTGGGGGGAAGGAGG + Intronic
903475789 1:23618476-23618498 TTGTAGCTCAGGTGGGGAGAGGG - Intronic
903661950 1:24983836-24983858 GTTGAGGTGTGGTGGGATGAGGG + Intergenic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903922659 1:26811812-26811834 TTGTGGGTCTGGTGGCAACAAGG - Intergenic
906461615 1:46038956-46038978 TTGTAGGTTTGGTGGTAGGAAGG + Intergenic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
907749710 1:57250979-57251001 TTATATGTGTGGTGGTATGAGGG + Intronic
908029510 1:59984875-59984897 TTGTGTGTGTTGTGGGAGGAGGG + Intergenic
909229967 1:73075309-73075331 TTGAAGGGGAGGTGGGAAGAGGG - Intergenic
910328532 1:86040460-86040482 TTGTAGGGGTGGGGGGAGGGGGG - Intronic
913098847 1:115544865-115544887 GTGTATGTGTGGTGGGAGGCAGG + Intergenic
913706749 1:121433463-121433485 TTGTAGGGGTAGGGGGATGATGG - Intergenic
914385793 1:147168906-147168928 TGGAAGCTGAGGTGGGAAGATGG - Intronic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
915968574 1:160334893-160334915 TAGTAGGTGTGTCTGGAAGAAGG - Intronic
916602243 1:166304385-166304407 TTGTGGGTGGGGCGGGAAGCGGG + Intergenic
917349684 1:174063954-174063976 TGGTGGCTGAGGTGGGAAGATGG + Intergenic
917509687 1:175659824-175659846 TGGCAGGTGTGGTGGGGAGGAGG + Intronic
918277284 1:182965706-182965728 CTGTATGTGTGGTGGGGAGGTGG - Intergenic
919077595 1:192831740-192831762 TTGTAGGTGTGGTCTCAAGGGGG - Intergenic
919787861 1:201271309-201271331 GTGGAGATGGGGTGGGAAGATGG + Intergenic
920675397 1:208034629-208034651 ATGTAGGTGTCTTGGGAAGTTGG + Intronic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922074540 1:222230434-222230456 TGGAAGGGGTGGGGGGAAGAAGG - Intergenic
922707648 1:227797762-227797784 TGGGAGGTGAGGTGGGAGGATGG + Intergenic
922849225 1:228718255-228718277 TTGTAGCCATGCTGGGAAGATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923649858 1:235864342-235864364 GAGTAGGTTTGGTGGGGAGAAGG - Intronic
923678457 1:236100182-236100204 ATGCAGAGGTGGTGGGAAGAAGG - Intergenic
924057658 1:240139744-240139766 TGTAGGGTGTGGTGGGAAGATGG + Intronic
1064548278 10:16473230-16473252 TTAGAGGTGGGGTGGGCAGAAGG - Intronic
1065432951 10:25677931-25677953 TTGAAGATGTGGTTGGCAGAGGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066192893 10:33072001-33072023 TTCAAGCTGTGATGGGAAGAGGG + Intergenic
1066227127 10:33394187-33394209 TTGTAGGTAGGGTTGGAGGAGGG + Intergenic
1067019975 10:42786811-42786833 TTGTAGCTCTAGTGGGAATACGG + Intronic
1069044861 10:63732559-63732581 TTTTATGTGTGGTAAGAAGAAGG + Intergenic
1069240287 10:66129965-66129987 ATGGTGGTGTGGTGGGGAGAAGG - Intronic
1069342148 10:67423634-67423656 TGGTATGTTTGGTGGGGAGAAGG - Intronic
1070359745 10:75676056-75676078 TCCCAGGTGTGGTGGGGAGAGGG + Intronic
1070493225 10:76996772-76996794 TGGTAGTGGTGGTGGAAAGAGGG + Intronic
1070817881 10:79336514-79336536 GGGGAGGTGTGGGGGGAAGAGGG + Intergenic
1070889929 10:79935732-79935754 ATGTAGGAGTGTCGGGAAGAGGG + Intergenic
1071129213 10:82371947-82371969 TTGTGGGGGTGTTGGGAGGAGGG - Intronic
1071755021 10:88527665-88527687 GTGTATATGTGGGGGGAAGAGGG - Intronic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1072881841 10:99235906-99235928 TTGGGGGGGTGGTGGGAGGAAGG - Intergenic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074168226 10:110905555-110905577 TTGGAGGGGTGGGGGGAGGACGG - Intronic
1074641478 10:115388056-115388078 TTTTATGTGTAGTGGGAAGAAGG + Intronic
1075549524 10:123381938-123381960 ATGTAGTTGTGGTGGGTAGTAGG + Intergenic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076225503 10:128771635-128771657 CTGGAGGAGTGGTGGGAAGGGGG + Intergenic
1076371010 10:129953685-129953707 CTGTAGGGGTGGTGGGAGCAGGG - Intronic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1077175264 11:1186800-1186822 TTGTACTGGTGGTGGGAACAGGG - Intronic
1077176095 11:1191471-1191493 TTGTGCTTGTGGTGGGAACAGGG - Intronic
1079733031 11:23959964-23959986 ATGTAGGTGTGGTAGGTAGGTGG + Intergenic
1080563997 11:33491402-33491424 TGTTAGGGGTTGTGGGAAGAAGG + Intergenic
1080888956 11:36391953-36391975 GGGTAGTTGTGGTGGGAGGAAGG - Intronic
1080961969 11:37171386-37171408 GTGTGCGTGTGGTTGGAAGAGGG + Intergenic
1081083248 11:38768954-38768976 TTGGAGGTACAGTGGGAAGAGGG - Intergenic
1081632988 11:44701938-44701960 AGGTAGATGTGGTGGGCAGAAGG - Intergenic
1083878478 11:65537008-65537030 TTGTAGGGGTGGCAGGAACAGGG - Exonic
1084720361 11:70901852-70901874 ATGGATGTGTGGTGGGAGGAAGG + Intronic
1084889080 11:72227956-72227978 GTGTAGGTCTGGTGGGGAGACGG + Intronic
1084906778 11:72354605-72354627 ATGCAGGTGTGGTGGGAGGGAGG - Intronic
1085013600 11:73158069-73158091 TGGGGGGGGTGGTGGGAAGATGG + Intergenic
1086426185 11:86684762-86684784 TTGGAGGTATGGTGGAAAGGGGG + Intergenic
1086438204 11:86801766-86801788 TTGGAGGTGAAGTGGGGAGAAGG + Intronic
1086497505 11:87419734-87419756 TTGTGGGTGTGGGAGGAAGGAGG - Intergenic
1086700801 11:89898575-89898597 AAGTTGGTGTGGTGGGAAGTTGG - Intergenic
1086705368 11:89945952-89945974 AAGTTGGTGTGGTGGGAAGTTGG + Intergenic
1086976941 11:93142943-93142965 TTGGGGGTGGGGTGGGAGGAGGG + Intergenic
1088678147 11:112216214-112216236 TTGCAGGTTTGGAGAGAAGATGG + Exonic
1088795121 11:113261158-113261180 GTTCAAGTGTGGTGGGAAGACGG + Intronic
1088884955 11:113999057-113999079 TTGTACGTGGGGTGGGTGGAGGG + Intergenic
1089261109 11:117224601-117224623 GTGGAGGTGGAGTGGGAAGATGG + Intronic
1089514997 11:119026696-119026718 AGGGAGTTGTGGTGGGAAGAGGG + Intronic
1089685061 11:120141521-120141543 ATGTTGGGGTGGTGGGACGAGGG - Intronic
1090321028 11:125844107-125844129 TTGTAGGGGAGGTGCCAAGATGG + Intergenic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1090988693 11:131796399-131796421 TAGTAGGTGTTGAAGGAAGATGG + Intronic
1091409112 12:227652-227674 TTGTAGGTGTGGATGGATGCAGG - Exonic
1092999034 12:13978327-13978349 TTGTAGACGTGGTGAGAACATGG + Intronic
1093185865 12:16019539-16019561 TTGGAGGTGAGGTGGGAGGAGGG - Intronic
1093782809 12:23156254-23156276 TTGTGGGGGTGGGGGGAAGGGGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094320811 12:29180933-29180955 TTTTTGGTGTGGTAGGAGGATGG + Intronic
1094524537 12:31222914-31222936 CTGCAGGTCTGGTGGGATGACGG + Intergenic
1094725760 12:33114085-33114107 TCGAGGGAGTGGTGGGAAGAGGG + Intergenic
1096312142 12:50530738-50530760 TTGTAGGTGTGATAGGAGAAAGG + Intronic
1096495963 12:52039580-52039602 TTGGAGCTGTGCTGGGAGGAAGG - Intronic
1098061943 12:66572414-66572436 TTGGGGGTGGGGTGGGAGGAAGG - Intronic
1101044338 12:100789082-100789104 TTCCATGAGTGGTGGGAAGAAGG - Intronic
1102573670 12:113842909-113842931 TGGGAGGTGTGGTGGGAGGAAGG + Intronic
1102732096 12:115120631-115120653 TTGAGGGTGGGGGGGGAAGAGGG + Intergenic
1103966310 12:124642053-124642075 ATGTAGGGGTGTTGGGCAGAAGG + Intergenic
1103974870 12:124695938-124695960 TTGGAGGAATGGTGGTAAGAGGG + Intergenic
1104042879 12:125141933-125141955 TTGCAGACCTGGTGGGAAGAGGG + Intronic
1105225108 13:18424758-18424780 CTTTAGGTGTGGAGGGAAAAGGG - Intergenic
1105515774 13:21089635-21089657 TTGTAGAAGTGGAGGGTAGAGGG + Intergenic
1106295427 13:28409231-28409253 TTTTGAGTGTGGTGGGAAGAGGG - Intronic
1106597157 13:31154868-31154890 TTGTAGTTGTTTTGGGAAGAAGG + Intronic
1107461836 13:40611730-40611752 CTGTAGCTGTGATGGGAGGAGGG - Intronic
1109452655 13:62538456-62538478 TGGTAGATTTGGTTGGAAGAAGG - Intergenic
1109985580 13:69979469-69979491 TTGGATATGTGATGGGAAGAAGG - Intronic
1110362576 13:74643946-74643968 TTTTAGATTTGGTGGTAAGAGGG - Intergenic
1112099948 13:96177635-96177657 TTGTAGGGAGGGTGGGAGGAGGG + Intronic
1113966155 13:114155127-114155149 GTGTAGGTGTGGGGGCATGATGG + Intergenic
1114812303 14:25915472-25915494 TGGTAGGTGTGTTGGGTAGTAGG - Intergenic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1117098437 14:52320968-52320990 TTGTATGAGTTGTGGGTAGATGG + Intronic
1118078014 14:62323624-62323646 TGGGAAGGGTGGTGGGAAGAGGG - Intergenic
1118090790 14:62474996-62475018 GGGTAGGTGTGGTTGGAAAAAGG - Intergenic
1118662893 14:68034276-68034298 TTGGTGGTGGGGTGGGAACATGG + Intronic
1119483834 14:74975729-74975751 GTGTATGTGTGGTGGGAAGGAGG - Intergenic
1120883368 14:89432502-89432524 CTGTAAGGGTGGTGGAAAGATGG - Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121348753 14:93155934-93155956 TTGTAGTTTGGATGGGAAGAAGG - Intergenic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1123430589 15:20212297-20212319 TTGGAGCTGAGGTGGGAGGATGG - Intergenic
1124077528 15:26460575-26460597 GTGTAGGGGTAGTGGGCAGATGG - Intergenic
1125608523 15:40955983-40956005 ATGTTGGTGTGGTGGGCAGGTGG + Exonic
1126783105 15:52155184-52155206 AGGTAGGTGAGGAGGGAAGAGGG + Intronic
1126808759 15:52379892-52379914 TTGTAGGTTTGATGAGAAGAGGG - Exonic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1128523352 15:68390207-68390229 TTGTGAGTGAGGTGGGAAGAAGG + Intronic
1129104041 15:73293288-73293310 TTGTATGGGAGGTGGGAAGGGGG + Intronic
1130095215 15:80850666-80850688 TTGAAGGTGTGGAGGGAAGGGGG + Intronic
1132290495 15:100698877-100698899 TTGGGAGTGAGGTGGGAAGATGG - Intergenic
1132362126 15:101225171-101225193 TTGGAGGTGAGGTGGGAAGATGG - Intronic
1134054418 16:11160525-11160547 ATCTAGGTGTGGTGGGCTGAAGG - Intronic
1134056428 16:11173065-11173087 TGGGAGGTGTGGTGGGGTGAAGG - Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134754374 16:16653133-16653155 TGGAAGGTGTTCTGGGAAGAGGG + Intergenic
1134758638 16:16693351-16693373 TTTTAGGTATGATGTGAAGAAGG + Intergenic
1134792011 16:16997596-16997618 TGGGAGGCGTGGAGGGAAGAGGG - Intergenic
1134987436 16:18665830-18665852 TTTTAGGTATGATGTGAAGAAGG - Intergenic
1134991687 16:18705901-18705923 TGGAAGGTGTTCTGGGAAGAGGG - Intergenic
1135640932 16:24119334-24119356 TTTTTGGGGGGGTGGGAAGAGGG - Intronic
1136854048 16:33638920-33638942 TTGGAGCTGAGGTGGGAGGATGG + Intergenic
1138028780 16:53542547-53542569 TGGCAGGTGTTGTGGGAAGGCGG + Intergenic
1138736758 16:59259873-59259895 TTGTGGGTGGGGTGGGATGGGGG + Intergenic
1139331988 16:66200073-66200095 TTGGAGGTGTGGTGGGCTGGGGG - Intergenic
1139363883 16:66421458-66421480 TTGGACGTGTGGTTGAAAGATGG + Intergenic
1139754851 16:69134018-69134040 TTTTTGGTGATGTGGGAAGATGG + Intronic
1140101429 16:71921066-71921088 TTGGAAGTGAGGTGGGGAGAAGG + Intronic
1141829272 16:86500594-86500616 TATTAGGTGTTGTGGGAAGCTGG + Intergenic
1144652951 17:17018615-17018637 TGGTAGGTGTTGTTGGAGGATGG + Intergenic
1145929478 17:28674873-28674895 GAGTAATTGTGGTGGGAAGAAGG + Intronic
1146830353 17:36063719-36063741 TTTTATGTTTGGTGTGAAGAAGG - Intergenic
1147612361 17:41809557-41809579 GTCTAGGGGTGGTGGGAATATGG - Intronic
1148458990 17:47826987-47827009 TGGTGGGGGTGGGGGGAAGATGG + Intronic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1149208436 17:54276336-54276358 TTGGAGGTGTGGGGGGCAGAGGG + Intergenic
1150462670 17:65365590-65365612 TTGAAGGTGTTGGGGGAACAGGG + Intergenic
1151013556 17:70529677-70529699 TTGAAGCTGAGGTGGGAGGAGGG + Intergenic
1151261672 17:72920586-72920608 TTGTAGAGGGGGTGGGAAGAGGG - Intronic
1151546533 17:74796733-74796755 TTGCAGGTCTGGTGGGAATTTGG + Intronic
1151600535 17:75103500-75103522 TTGTAGTTTTGGTAGGAACAGGG + Intronic
1151932453 17:77241263-77241285 TTGAACATGTTGTGGGAAGATGG + Intergenic
1152058259 17:78049709-78049731 TTGCAGGTGGGGCGGGATGATGG - Exonic
1152118785 17:78405469-78405491 TGGTGGGGGTGGTAGGAAGAGGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1153157587 18:2167027-2167049 TTGTTGGTTTGCTGGGAAGAGGG + Intergenic
1153516343 18:5905781-5905803 TTGTAGGACAGGAGGGAAGATGG - Intergenic
1154280367 18:12996861-12996883 TTGGTGGTGTGGTGGGATGAAGG + Intronic
1156203196 18:34857218-34857240 TCGTGGGTGTGGTGAGAAGATGG - Intronic
1156437464 18:37148121-37148143 TGGGAGGTGTGGTGGGGGGAGGG - Intronic
1156893958 18:42222778-42222800 TTGTAGCTTTGGCAGGAAGAGGG - Intergenic
1157330138 18:46698053-46698075 TTGTTGGTGTGGTGGGTTGTGGG - Intronic
1157330162 18:46698219-46698241 TTGTTGGTGTGGTGGGTTGTTGG - Intronic
1157330173 18:46698288-46698310 TTGTTGGTGTGGTGGGTTGTTGG - Intronic
1157330196 18:46698456-46698478 TTGTTGGTGTGGTGGGTTGTTGG - Intronic
1157436106 18:47670727-47670749 TGGTAGGTGGGATGGGGAGAAGG - Intergenic
1157693126 18:49699998-49700020 TTTCAGGTGTCTTGGGAAGAAGG + Intergenic
1157827605 18:50826414-50826436 ATGGAGTTGTGGTGGGAAGCTGG - Intergenic
1158239513 18:55361138-55361160 TTCTAGGTGAGGTTGGATGATGG - Intronic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1160773891 19:846065-846087 TGGTGGGTGTGGTGGGAGGGCGG + Intronic
1161952951 19:7477734-7477756 TGGGAGGTGTGGAGGGAAGGGGG + Intronic
1162197049 19:8992979-8993001 TTTTTGGGGTGGTGGGGAGACGG + Intergenic
1163278530 19:16300832-16300854 TTTTTGGTGGGGTGGGCAGAGGG + Intergenic
1164483752 19:28637232-28637254 TTGTGGGATGGGTGGGAAGATGG + Intergenic
1164634726 19:29784191-29784213 CTGAAGGTGTGGGGAGAAGAGGG + Intergenic
1164705316 19:30314995-30315017 TAGTAGGCGTGGTGGGGAGGAGG - Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166895319 19:46018844-46018866 TTGGCTGTGTGGTGGGAAGGAGG + Intronic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167304212 19:48697496-48697518 TTGTAGGGATGGTGGGGAGGGGG - Intronic
1168464973 19:56594951-56594973 AAGTAGGAGAGGTGGGAAGAAGG - Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
926618449 2:15022965-15022987 ATGTAGGTGAAGGGGGAAGATGG - Intergenic
926627393 2:15103551-15103573 TTGTAAGTTTTTTGGGAAGATGG + Intergenic
927446382 2:23165707-23165729 TTGCAACTGAGGTGGGAAGATGG - Intergenic
927888004 2:26730360-26730382 TTGCAGGTGTGGTGGGCAGAGGG - Exonic
928053661 2:28028374-28028396 GTGTAGGTGTGTTGGGAGGGTGG - Intronic
928424327 2:31165679-31165701 TTGAGAGTGTGGTGGGGAGAGGG - Intergenic
928863162 2:35884820-35884842 TTGTAGGGTTGGTGTGAAGATGG - Intergenic
930067069 2:47335797-47335819 CTGTTGGTGGGGTGGGAGGAGGG - Intergenic
930367527 2:50459455-50459477 TTGAGGGTGGAGTGGGAAGAGGG - Intronic
931881286 2:66573969-66573991 GAGGAGGTGTGGTGGGGAGAGGG + Intergenic
932120115 2:69090994-69091016 TTGTTGGTGGGGTGGGAAAGAGG + Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932694045 2:73939029-73939051 TTTTAGTTGTGGTGGGTAGTTGG + Intronic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
933158622 2:79000547-79000569 GTGTATATGTGGTGGGAAGTGGG - Intergenic
935591644 2:104850988-104851010 GTGAAGGTGGGGTGGGAGGAGGG - Intergenic
936417506 2:112330620-112330642 TTGTATGTGTGGTGGGCTGTAGG - Intronic
938179813 2:129170304-129170326 GTGAAGGGGAGGTGGGAAGATGG - Intergenic
938615124 2:132989710-132989732 TTGATGGTGTGGTGGAAAGTAGG - Intronic
939054081 2:137341641-137341663 TTGTATGTGTTGTGGGATTAAGG + Intronic
939464871 2:142544368-142544390 CTGTAGGTACGGTGGGAAGCAGG - Intergenic
940000575 2:148963063-148963085 TTGTGGGTGAGGTGTTAAGAGGG + Intronic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
941211966 2:162651357-162651379 TTGGGGGTGGGGTGGGAGGAGGG - Intronic
942255521 2:174093205-174093227 TTGGGGATTTGGTGGGAAGATGG + Intronic
944241434 2:197489231-197489253 TTGTAGGTGTTTGGAGAAGAGGG - Exonic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
945706186 2:213235072-213235094 TTGTAGGTGTGTTTGGAGGCAGG + Intergenic
945750140 2:213771623-213771645 TTTTATGTGTGGTGTAAAGAAGG + Intronic
945960574 2:216130152-216130174 TTCTATGTTTTGTGGGAAGAAGG - Intronic
946029240 2:216691959-216691981 TAGGAGGTGTGTTGGGAAGCAGG + Intronic
946628101 2:221636622-221636644 TTCTCAGTGTGGTGGGAAGTCGG + Intergenic
946743695 2:222825674-222825696 TAGAAGGTGTGATGTGAAGATGG - Intergenic
947198078 2:227588817-227588839 TTTTATGTATGGTGTGAAGAAGG - Intergenic
948090042 2:235285826-235285848 GTGTAGGTGGTCTGGGAAGAGGG + Intergenic
948667177 2:239543865-239543887 TTGAGGGTGTGGTGGGGAGGTGG - Intergenic
948825424 2:240571484-240571506 ATGTGGCTGTGGTTGGAAGAGGG + Intronic
1169533405 20:6509780-6509802 TTTTGGGGGTGATGGGAAGAGGG + Intergenic
1169750445 20:8987407-8987429 TGGTAGCTGAAGTGGGAAGAAGG - Intergenic
1170036608 20:11996358-11996380 TTGTTGGGGTGGTGGGTGGAGGG - Intergenic
1170360219 20:15537782-15537804 TTGTAAGAGTTGTGAGAAGAAGG - Intronic
1170661290 20:18343157-18343179 TTGGTGGGGTGGTGAGAAGAGGG - Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173219090 20:41116576-41116598 TTGAAGTTGGGGTGGGAAGGGGG - Intronic
1173349718 20:42233633-42233655 TGGTAGTTGGGATGGGAAGATGG + Intronic
1173631988 20:44523320-44523342 GTGTATGTGTGGTGAGGAGAGGG - Intergenic
1174031907 20:47635560-47635582 TTGTTGTTCTGGTAGGAAGATGG - Exonic
1174490352 20:50888872-50888894 TTGTGGGTGTCGGGGGAAGGGGG - Intergenic
1174910789 20:54605484-54605506 TTGGGGAGGTGGTGGGAAGAGGG - Intronic
1175062811 20:56259192-56259214 GTGGAGGGGTGGTGGGAAGATGG - Intergenic
1175169167 20:57067888-57067910 TTCTTGGTGTGTTGGTAAGAGGG - Intergenic
1175773982 20:61641578-61641600 CTGTAGGTGTGGTGGGATCAGGG - Intronic
1179647502 21:42784672-42784694 GTGGGGGTGTGGTGGGATGAGGG - Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180914952 22:19479518-19479540 TTTTTGGTGTGGTTTGAAGAAGG - Intronic
1181527776 22:23500043-23500065 GTGGAGGTGAGGCGGGAAGAGGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1184094258 22:42308159-42308181 TGGTAGCTGGGGTGGGGAGAGGG + Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1184802093 22:46767667-46767689 TGGCAGGTGTGGTGGTGAGAAGG + Intronic
949802501 3:7918969-7918991 ATGTAGGTGTGGGATGAAGAAGG + Intergenic
949880618 3:8657956-8657978 TTGGAGTTGTCGTGGGGAGAAGG - Intronic
950280241 3:11701031-11701053 TTGTAGGGGTGGTGGCAGGAGGG + Intronic
951053371 3:18119629-18119651 TTGTATCTGTGGTGTGAATAGGG + Intronic
951548274 3:23851061-23851083 TTTTGTGTGTGGTGTGAAGAAGG + Intronic
952005656 3:28839436-28839458 TGGAAGGTCTGGTGGGAACATGG + Intergenic
952931459 3:38364222-38364244 TTGGATGTGGGGTGGGAAGGTGG - Intronic
954489228 3:50885876-50885898 TTTTTGGTGTGGGGGGCAGAGGG + Intronic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
955017586 3:55087340-55087362 CAGTAGGTTTTGTGGGAAGATGG - Intergenic
955341378 3:58128024-58128046 TCTTAGGTGTGGTGTGAAGAGGG + Intronic
955349460 3:58183196-58183218 TTGTAACTGTGGTGGGGAAAGGG - Intergenic
955984085 3:64555311-64555333 TAGGAGGTGCGGTGGGGAGAAGG + Intronic
956289752 3:67648957-67648979 TTGTAGGAGAGCGGGGAAGACGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957731806 3:84148541-84148563 TTGGAAGGGTAGTGGGAAGATGG - Intergenic
958584209 3:96065160-96065182 TGGTAGGTTAGGTGGGAAGAAGG + Intergenic
959427364 3:106207540-106207562 TGGGAGGTGAGGTGGGCAGATGG + Intergenic
960970262 3:123134556-123134578 TGGCAGGAGTGCTGGGAAGAGGG - Intronic
962286193 3:134087260-134087282 GTGTAGGTGTGGTAAGAAGTGGG + Intronic
962944441 3:140154434-140154456 TTCTAAGTGTGGTGGGCAGCTGG + Intronic
963080529 3:141389126-141389148 CTATAGGTGTGTTAGGAAGATGG + Intronic
963882862 3:150547337-150547359 ATGAAGGTGTGGTTGGGAGAGGG + Intronic
963895024 3:150676538-150676560 TTGTAGGTGTGATTTGAAGGTGG + Intronic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
965527656 3:169738749-169738771 TTCTAGCTGAGGTGGGAGGATGG - Intergenic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
966911110 3:184560871-184560893 AAGTAGGTGTTGGGGGAAGAAGG - Intronic
967228403 3:187314625-187314647 TGGGAGGTGCAGTGGGAAGATGG + Intergenic
967511704 3:190320993-190321015 TTCTAAGGATGGTGGGAAGAAGG - Intronic
968120326 3:196121449-196121471 GTGTAGGTCTGGTGGGTAGGGGG - Intergenic
969359717 4:6655646-6655668 TTGTGGGGTTGGTGGGGAGAGGG + Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
970211640 4:13716046-13716068 TTATAGAGCTGGTGGGAAGATGG + Intergenic
970364917 4:15348978-15349000 TTCTAGGGGTGTTGGGAGGATGG - Intronic
970559576 4:17269479-17269501 TAGTAGGTGTGGAGTGAGGAGGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971354478 4:25882668-25882690 TTGGGGGTGGGGTGGGACGAGGG + Intronic
972797997 4:42441656-42441678 ATGTGGGTGTGGTGGGATGTGGG - Intronic
973020631 4:45201235-45201257 TGGTAGGTGTTATGGGAAGGAGG + Intergenic
973191559 4:47391459-47391481 TTGCAGTTGAGGTGGGGAGAAGG - Intronic
973791206 4:54379759-54379781 TTTTAGGTGGGGTGGGAGGCAGG - Intergenic
975535952 4:75450583-75450605 TTCTCGGGGTGGGGGGAAGAAGG - Intergenic
975672444 4:76795086-76795108 TTTTGTGTGTGGTGTGAAGAGGG - Intergenic
978783989 4:112588998-112589020 TTATGGGTGTGGTTGGTAGAAGG - Intronic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
983644532 4:169976562-169976584 GTGCAGGTGTGGTGGGAAGGGGG + Intergenic
985102217 4:186469802-186469824 TGGAAGCTGAGGTGGGAAGATGG + Intronic
985174851 4:187189808-187189830 TTGTAGGTGTAAAGGCAAGAAGG - Intergenic
985189788 4:187360316-187360338 TTGTATTTGGGGAGGGAAGAAGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
985864481 5:2503526-2503548 TTGCAGCTGTGAAGGGAAGAGGG + Intergenic
986541773 5:8851968-8851990 TAGTGAGTGTGGTGGGAGGATGG - Intergenic
986624097 5:9707278-9707300 TTGGAGGTGTGCTGGGGAGTTGG - Intronic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
986741674 5:10710550-10710572 CTGGAAGTGTGGTGGGATGATGG + Intronic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
987645879 5:20671959-20671981 TTGTAGCTGTGGTGGATACAAGG + Intergenic
988013396 5:25519933-25519955 TTGTAATTGTGCTGGTAAGAAGG + Intergenic
988643568 5:33068826-33068848 GATTAGGTGTGGTTGGAAGAGGG + Intergenic
988832135 5:34998212-34998234 TTTTTGGTGAGGTTGGAAGATGG - Exonic
989163001 5:38409646-38409668 TAGTGGATGTGATGGGAAGAAGG + Intronic
989970914 5:50522435-50522457 TTGTAGGGGTAGGGGGATGAAGG + Intergenic
990295525 5:54397962-54397984 TTCAAGGTGTGTGGGGAAGATGG - Intergenic
991047828 5:62241262-62241284 TTGGAGCTGAGGTGGGAGGATGG - Intergenic
992058753 5:73020613-73020635 TTGGAGGTGGGGTTGGTAGAAGG + Intronic
992606712 5:78464852-78464874 TTATAGTGGTGGTGGGAAGAAGG + Intronic
992728207 5:79630728-79630750 TGGTAGGGGAGATGGGAAGAGGG + Intronic
993039273 5:82794031-82794053 TTGCTAGTGTGGTGGGAAGGAGG + Intergenic
993107680 5:83617856-83617878 ATGTAGGTGTGGTGGGACCTGGG + Intergenic
994379934 5:99058717-99058739 TTGTAGAGGTTGTGGGAGGAAGG + Intergenic
994821972 5:104664244-104664266 TTATAGGTGTTGTGGGACGCAGG + Intergenic
995505513 5:112856047-112856069 TCATTGTTGTGGTGGGAAGATGG + Intronic
996131061 5:119780984-119781006 GTGTAGGGGTGGTGTGATGAAGG + Intergenic
996585332 5:125081357-125081379 TTGAAGTTGTGGTGATAAGATGG - Intergenic
997228802 5:132228304-132228326 TTGTGGTGGTGCTGGGAAGAAGG - Intronic
997368135 5:133338873-133338895 TGGTAGGAGTGGTGGGAAACTGG - Intronic
997731625 5:136184473-136184495 TTGGATGGGAGGTGGGAAGAGGG + Intronic
997943849 5:138182122-138182144 TTGTTGATTTGGTGGAAAGATGG + Intronic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998274680 5:140741326-140741348 TGGAAGTTGTGGTGGGTAGAAGG + Intergenic
999275927 5:150330211-150330233 TTGAAGGTGTGGGTGGAAGAAGG + Intronic
999311762 5:150555992-150556014 TTGCAGGTATGGGGGGTAGAAGG + Exonic
1000161600 5:158602882-158602904 TTGAAGGTGTGGTGGGACAGAGG - Intergenic
1001566961 5:172706082-172706104 TGGTGGCTGTGGTGGGGAGAAGG + Intergenic
1002373084 5:178769990-178770012 TTCTTGGGGTGGTGGGAGGAGGG + Intergenic
1002530787 5:179843497-179843519 TGGGAGCTGAGGTGGGAAGATGG + Intronic
1005986880 6:30881227-30881249 CTGGAGGTGTGTTGGGAGGAGGG + Intronic
1006052209 6:31353823-31353845 TTGCAGGTGGGGTGTGGAGAAGG - Intronic
1006147340 6:31967540-31967562 TTCTTGGGGTGGTGGGAGGAAGG - Intronic
1007615815 6:43179390-43179412 TGGGAGGTGGGGCGGGAAGAAGG - Exonic
1007762208 6:44139689-44139711 TTCTCTGTGGGGTGGGAAGAGGG - Exonic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008517968 6:52335994-52336016 TGGTAGGTGCTGTGGGAAGATGG - Intergenic
1009410669 6:63361786-63361808 TTGTAGGGGTGGAGCCAAGATGG - Intergenic
1009889272 6:69660580-69660602 TTTTACGTGTGGTGTAAAGAAGG - Intergenic
1010577366 6:77549165-77549187 TGGTAGCTGAGGTGGGAAGATGG - Intergenic
1011191294 6:84731076-84731098 ATCCAGGTGTGTTGGGAAGAGGG + Intronic
1011403619 6:86992079-86992101 TTGTAAGTGGGATGGGTAGAGGG - Intronic
1011731070 6:90264352-90264374 TTGTATGTGTGTTGGCAAGAGGG - Intronic
1012420197 6:99056468-99056490 TTATAGTTGTGGTGGGTAGGAGG + Intergenic
1013030182 6:106325441-106325463 AGGTAGGTGTGGTAGGAAGGAGG - Intronic
1013097215 6:106956514-106956536 TTTTTGGTGTAGTGGGGAGAAGG - Intergenic
1013225512 6:108117600-108117622 ATGTGCGTGTGGTGCGAAGAGGG + Intronic
1013474756 6:110497090-110497112 GTGTAGGTGTGGTGGAGAGGGGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013837008 6:114344397-114344419 TGGTAAGAGTGGTGGGAGGAAGG - Intergenic
1016050809 6:139528089-139528111 ATGTATGTGTGGGGGGAAGGAGG + Intergenic
1016215226 6:141591758-141591780 ATGCAGATGGGGTGGGAAGAGGG - Intergenic
1017905930 6:158757539-158757561 TTGTGGGTGGGGTGGGCGGAGGG + Intronic
1018242784 6:161794738-161794760 TTGTAGTTTTGGGGGGAATAAGG - Intronic
1018383855 6:163285177-163285199 TTGCAGGTGGGGTGGGGAGAGGG - Intronic
1018650034 6:165985848-165985870 TTGAAGCTGTGTGGGGAAGAAGG - Intronic
1019059185 6:169243100-169243122 AGGTAGGAGTGGTGGGAAGGTGG - Intronic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019395862 7:817111-817133 TGGGTGGGGTGGTGGGAAGACGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020375674 7:7482919-7482941 GTGTTTGTGTGGTGGGAAGAAGG + Intronic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021023618 7:15636506-15636528 TTGTAGCTGTATTGGCAAGAAGG + Intronic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1023105445 7:36759432-36759454 TTGTAGCTGTGGAGGGAAAAGGG - Intergenic
1023277311 7:38533806-38533828 TTAGAGGTGGGGTAGGAAGAAGG - Intronic
1023344765 7:39260016-39260038 TTGTATGTGTGGTGTGAGCATGG - Intronic
1023344789 7:39260296-39260318 TTGTGTGTGTGGTGTGAACATGG - Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1024295965 7:47842579-47842601 ATGAAGATGGGGTGGGAAGAAGG - Intronic
1026324964 7:69301070-69301092 TGGTGGCTGAGGTGGGAAGATGG + Intergenic
1027140150 7:75650975-75650997 TTTTTTGTGTGGTGGGGAGAGGG - Intronic
1027441593 7:78224975-78224997 TTGGAGGTGAGGTGAGCAGAGGG - Intronic
1027774802 7:82450877-82450899 TTGTATGTGTGGCGGGGGGAGGG + Intergenic
1031424486 7:121588753-121588775 TTGTAGATTTGGTGGATAGAAGG + Intergenic
1031870917 7:127089497-127089519 TTGCCCATGTGGTGGGAAGATGG - Intronic
1033157345 7:138968186-138968208 CGGTAGGTGGGGTGGGAGGAGGG + Intronic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033999241 7:147391124-147391146 TTGTATATGTGGTGTGAGGATGG - Intronic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036776681 8:11617666-11617688 TTGGGGGTGTGGGAGGAAGAGGG - Intergenic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1036968679 8:13329509-13329531 CTGTAGTTGTGATGGGAAGGAGG - Intronic
1037256279 8:16958630-16958652 TTGTAGATGTGGTGAGAATGAGG - Intergenic
1037369293 8:18157260-18157282 TTTTTGGTGTGGTGGGTACAGGG - Intergenic
1037458107 8:19083547-19083569 GTCTAGGTGTGTTGGGGAGATGG + Intronic
1038328845 8:26591849-26591871 TTGCAGGGGAGGTGGGCAGAGGG - Intronic
1039924346 8:41915736-41915758 TTGCAGGTTTGGGGGGAAGATGG - Intergenic
1045246000 8:100442169-100442191 AATTAGGTCTGGTGGGAAGAGGG + Intergenic
1045817746 8:106296455-106296477 TTGTAACTGTGGAAGGAAGATGG + Intronic
1046271413 8:111902364-111902386 TTCAAGCTGTGGTGTGAAGAAGG - Intergenic
1046996210 8:120526735-120526757 TGGTGGGTGGGGTTGGAAGAGGG + Intronic
1047071148 8:121344848-121344870 TTGTACGTGTGTTGGGGTGAGGG - Intergenic
1047601189 8:126427212-126427234 GGATTGGTGTGGTGGGAAGAGGG + Intergenic
1048048952 8:130799127-130799149 TGGGGGGTGGGGTGGGAAGAGGG + Intronic
1048186104 8:132242287-132242309 ATGGAGGTGGGGTGGGTAGAAGG + Intronic
1049286690 8:141779658-141779680 GTGTTGGTGTGGTGTGATGATGG + Intergenic
1050095788 9:2064726-2064748 TTGTAGGAGTTGGGGGAACAGGG - Intronic
1050348403 9:4716246-4716268 TTGTGGGTGAGGTGGGGAGCTGG - Intronic
1051370942 9:16358503-16358525 TGGTAGGGATGGTGGGAAGTGGG + Intergenic
1052038982 9:23716387-23716409 TTGAAGATGTGGTCGGATGAAGG - Intronic
1052234614 9:26195021-26195043 TTGTAGGGGTTGTGGGAGGGAGG - Intergenic
1052739591 9:32380762-32380784 TAGCAGGTGTGGTGAGAAGAGGG + Intergenic
1052739778 9:32382333-32382355 TAGCAGGTGTGGTGGGAAGAGGG + Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056490247 9:87099110-87099132 TTGGAGGTTGGGTGGGAGGAGGG + Intergenic
1056772933 9:89492735-89492757 TTGCAGGTGTTCTGCGAAGACGG - Intronic
1057271075 9:93651817-93651839 TTGAGGGTGTGGTGGGAGGCAGG + Intronic
1057538889 9:95945796-95945818 ATATAGTTGTGTTGGGAAGATGG + Intronic
1057857707 9:98614721-98614743 TTGTTTCTGTGGAGGGAAGAAGG + Intronic
1058213269 9:102200020-102200042 TTGTTGGTGTTGTGAGAAAATGG - Intergenic
1059095283 9:111406796-111406818 TAGGAGGTGAGGTGGGAGGATGG + Intronic
1059570813 9:115433058-115433080 TTGTATGTGGGGTTGGGAGAAGG + Intergenic
1061070515 9:128307334-128307356 TGGAGGGTGAGGTGGGAAGATGG + Intergenic
1061070582 9:128307796-128307818 TGGAAGCTGAGGTGGGAAGATGG + Intergenic
1061256463 9:129456434-129456456 GTGGAGGTGAGGCGGGAAGAAGG + Intergenic
1061681023 9:132242458-132242480 GTGTAAGTGTGGTGGGAGGCAGG - Exonic
1186254889 X:7707772-7707794 TTGTAGGTGTGGGGAAAAGAAGG - Intergenic
1186699512 X:12074924-12074946 TTGTAGCTTGTGTGGGAAGAGGG + Intergenic
1186749399 X:12606184-12606206 TTGTTCCTGTGGTAGGAAGAGGG + Intronic
1187114580 X:16336210-16336232 TTTTATGTGTGGTGGGGAGTGGG + Intergenic
1187654849 X:21460070-21460092 GAGTATGTATGGTGGGAAGACGG - Intronic
1187677911 X:21736360-21736382 TGTAAGGTGTGGTGGGAGGAAGG + Intronic
1188340693 X:28997774-28997796 TTGTGGGGGTGGGGGGAACATGG - Intronic
1188406552 X:29817846-29817868 TTCTATGTGTGGTAGAAAGATGG + Intronic
1189797261 X:44657159-44657181 TTGTAGGGATAGTGGGATGATGG + Intergenic
1190002314 X:46700918-46700940 TTGATGGTGGTGTGGGAAGAGGG - Intronic
1192734889 X:73841257-73841279 TTGCAGATGAGGTGGGAAGAAGG + Intergenic
1193671777 X:84396540-84396562 TTGTGGCTGTGGTGGCCAGATGG + Intronic
1193912094 X:87317917-87317939 TGCTACCTGTGGTGGGAAGAAGG + Intergenic
1194128446 X:90049113-90049135 ATGTAGGTGTAGATGGAAGAGGG - Intergenic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194414269 X:93591169-93591191 TTTTTGGTGGGGTGGGTAGAGGG - Intergenic
1194504733 X:94719631-94719653 TTGAGGGAGTGCTGGGAAGAGGG - Intergenic
1195067478 X:101250619-101250641 TTGCAGGAAGGGTGGGAAGAAGG + Intronic
1195606404 X:106810278-106810300 TGGTAGAAGTGGTGGGAGGAGGG + Intronic
1196254317 X:113497980-113498002 TTGTATGTGTGGTGAGAGGAGGG + Intergenic
1196554455 X:117070503-117070525 ATGGTGGTGTGGTGGGAGGAGGG - Intergenic
1197264942 X:124359076-124359098 TTGGAGGGGTTGTGGGGAGAAGG + Intronic
1197564435 X:128064397-128064419 TGTTAGGTGTGGTGGGGAGAGGG + Intergenic
1198948671 X:142043743-142043765 TTGTAGGTGTGCAGTGAAGCAGG + Intergenic
1199487388 X:148362841-148362863 CTGTAGATGTGGTGGGTGGAGGG + Intergenic
1200342456 X:155411792-155411814 TGGTGGGTGTGGTGGAAATAGGG + Intergenic
1201470960 Y:14334529-14334551 CTGTAGGTGTGGGGAAAAGAAGG - Intergenic