ID: 1148588711

View in Genome Browser
Species Human (GRCh38)
Location 17:48799441-48799463
Sequence AGCACCCCGGTCAGAACGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 20}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148588704_1148588711 28 Left 1148588704 17:48799390-48799412 CCAATTGACAAGGGTAAAAGGAT 0: 1
1: 0
2: 0
3: 7
4: 165
Right 1148588711 17:48799441-48799463 AGCACCCCGGTCAGAACGTTTGG 0: 1
1: 0
2: 0
3: 3
4: 20
1148588708_1148588711 -9 Left 1148588708 17:48799427-48799449 CCCGGGCACGTGTCAGCACCCCG 0: 1
1: 0
2: 0
3: 13
4: 102
Right 1148588711 17:48799441-48799463 AGCACCCCGGTCAGAACGTTTGG 0: 1
1: 0
2: 0
3: 3
4: 20
1148588709_1148588711 -10 Left 1148588709 17:48799428-48799450 CCGGGCACGTGTCAGCACCCCGG 0: 1
1: 0
2: 0
3: 6
4: 147
Right 1148588711 17:48799441-48799463 AGCACCCCGGTCAGAACGTTTGG 0: 1
1: 0
2: 0
3: 3
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148588711 Original CRISPR AGCACCCCGGTCAGAACGTT TGG Intronic