ID: 1148591064

View in Genome Browser
Species Human (GRCh38)
Location 17:48817100-48817122
Sequence ACCCAAAGTTAGGGCGAGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148591064_1148591076 15 Left 1148591064 17:48817100-48817122 CCGCGCTCGCCCTAACTTTGGGT 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1148591076 17:48817138-48817160 ATTTGCATACGGGGCCTTCTAGG 0: 1
1: 0
2: 0
3: 4
4: 83
1148591064_1148591073 6 Left 1148591064 17:48817100-48817122 CCGCGCTCGCCCTAACTTTGGGT 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1148591073 17:48817129-48817151 GGCCCTCATATTTGCATACGGGG 0: 1
1: 0
2: 0
3: 6
4: 48
1148591064_1148591077 26 Left 1148591064 17:48817100-48817122 CCGCGCTCGCCCTAACTTTGGGT 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1148591077 17:48817149-48817171 GGGCCTTCTAGGCCTTCGATTGG 0: 1
1: 0
2: 0
3: 9
4: 55
1148591064_1148591071 4 Left 1148591064 17:48817100-48817122 CCGCGCTCGCCCTAACTTTGGGT 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1148591071 17:48817127-48817149 CCGGCCCTCATATTTGCATACGG 0: 1
1: 0
2: 0
3: 4
4: 70
1148591064_1148591072 5 Left 1148591064 17:48817100-48817122 CCGCGCTCGCCCTAACTTTGGGT 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1148591072 17:48817128-48817150 CGGCCCTCATATTTGCATACGGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148591064 Original CRISPR ACCCAAAGTTAGGGCGAGCG CGG (reversed) Exonic