ID: 1148603201

View in Genome Browser
Species Human (GRCh38)
Location 17:48909077-48909099
Sequence GAGGGTGGCCGGAATGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 439}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148603201_1148603209 -1 Left 1148603201 17:48909077-48909099 CCGTCTCCATTCCGGCCACCCTC 0: 1
1: 0
2: 3
3: 30
4: 439
Right 1148603209 17:48909099-48909121 CCCCCACACCTCCCACCTCCGGG 0: 1
1: 0
2: 14
3: 130
4: 1152
1148603201_1148603207 -2 Left 1148603201 17:48909077-48909099 CCGTCTCCATTCCGGCCACCCTC 0: 1
1: 0
2: 3
3: 30
4: 439
Right 1148603207 17:48909098-48909120 TCCCCCACACCTCCCACCTCCGG 0: 1
1: 2
2: 3
3: 80
4: 578
1148603201_1148603213 2 Left 1148603201 17:48909077-48909099 CCGTCTCCATTCCGGCCACCCTC 0: 1
1: 0
2: 3
3: 30
4: 439
Right 1148603213 17:48909102-48909124 CCACACCTCCCACCTCCGGGTGG 0: 1
1: 1
2: 2
3: 25
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148603201 Original CRISPR GAGGGTGGCCGGAATGGAGA CGG (reversed) Intronic
900327470 1:2115810-2115832 GAGGGTGGCGTGCCTGGAGAGGG - Intronic
901242376 1:7703182-7703204 GAGGGTGGCCAGATTTGAGCTGG + Intronic
902038626 1:13475939-13475961 GATGATGGCCGCAATGGACACGG + Exonic
902393406 1:16119150-16119172 GAGGGTGCCAGGAGTGGGGAGGG + Intergenic
903811261 1:26036175-26036197 GAGGGCGGCCGGGATGTGGAGGG + Exonic
904895480 1:33814258-33814280 TATGGTGGCAGGTATGGAGAAGG - Intronic
904910249 1:33929226-33929248 GAGGGTGGCCGGAGTAGAGGTGG - Intronic
905055520 1:35090264-35090286 TAGGGTGGCAGGAAGGGAAAGGG + Intronic
905530080 1:38671044-38671066 GAGGGTGGTGGGAAGGAAGAAGG - Intergenic
905868753 1:41391165-41391187 CAGGGTGGCAGGGATGGAGCAGG + Intergenic
907516047 1:54994113-54994135 GAGAGTGGCAGGAAATGAGAGGG - Intergenic
907867214 1:58410000-58410022 GAGGGTGGTGGGGATGGAGGTGG - Intronic
907946537 1:59140941-59140963 GAGGGTGGCGGCTGTGGAGATGG + Intergenic
908789795 1:67770272-67770294 CAAGGTGGGTGGAATGGAGAGGG + Intronic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
911243463 1:95490831-95490853 TAGAGTGGCCGGAGTGGTGATGG + Intergenic
912714799 1:111975494-111975516 GAGGGTGGTGGCAGTGGAGATGG - Intronic
913192399 1:116424719-116424741 GATGGTGGGAGGAATGGAGACGG + Intergenic
913713344 1:121509682-121509704 GAGGGTGGGAGGAAGGGAAAGGG + Intergenic
915145597 1:153794322-153794344 GGAGGTGGCCGGAGTGGAGATGG + Intergenic
915674298 1:157516024-157516046 GAGGGAGTTGGGAATGGAGAGGG - Intronic
917614936 1:176733106-176733128 GGGGGTGGAGGGAATGGAGGAGG - Intronic
919291342 1:195636091-195636113 GAGAGAGGGAGGAATGGAGAAGG + Intergenic
919735592 1:200948254-200948276 GAGGGGGGCCGGGGTGGGGAAGG + Intergenic
920685374 1:208105157-208105179 GAGGGTGGCCAGGATGGGGTGGG + Intronic
920750813 1:208674771-208674793 GAGCGTGGGCGGAGTGGTGACGG - Intergenic
922724122 1:227914684-227914706 GATGGTGGACGGAGTGGAGCAGG - Intergenic
922844052 1:228668963-228668985 GATGGTGGCCTGAATGAAAAGGG + Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923413691 1:233734186-233734208 GAGGGTCGAAGGAATGTAGAGGG - Intergenic
923756295 1:236794193-236794215 GAAGGTGGGGGGAATGGAGTAGG - Intergenic
1062987310 10:1780498-1780520 GAGGGTCCCCGTGATGGAGACGG + Intergenic
1063663661 10:8049746-8049768 GAGGCTGGCTGGGTTGGAGACGG + Intergenic
1064526435 10:16260824-16260846 GAGGGAGGCAGGGAGGGAGATGG + Intergenic
1066460457 10:35608273-35608295 GAGGGTGGGCGGGAGGAAGAGGG + Exonic
1066634981 10:37491289-37491311 GAGGGTGGAGGGTAGGGAGAGGG + Intergenic
1068073091 10:52220559-52220581 GAGGGTGGAGGGTAGGGAGAGGG - Intronic
1068763425 10:60736662-60736684 GAGGGAGAAGGGAATGGAGATGG - Intergenic
1068894270 10:62182114-62182136 TAGGGTGGAAGCAATGGAGATGG + Intergenic
1070658226 10:78285772-78285794 GTGGGTGGCAGGAAGGGACATGG + Intergenic
1070697573 10:78574219-78574241 GATGGTGCCAGGCATGGAGATGG - Intergenic
1071647338 10:87367069-87367091 GAGGGTGGCCTGAATGGGGAGGG + Exonic
1073467058 10:103700420-103700442 GATGGTGGCCGCAATGCAGGAGG + Intronic
1073625206 10:105089775-105089797 GTCGGTGGCCGGATTGGATAAGG + Exonic
1073911156 10:108346285-108346307 GAGGGTGGGTGGAGTGGAGCTGG + Intergenic
1074268970 10:111934065-111934087 GAGGGTGACGAGAATGCAGATGG - Intergenic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076854586 10:133109555-133109577 GGAGGAGGCTGGAATGGAGACGG - Intronic
1078550838 11:12279664-12279686 GAGAGAGGCAGGAAGGGAGAGGG - Intronic
1078901461 11:15646589-15646611 GAGGGAGGGAGGGATGGAGAGGG + Intergenic
1079778232 11:24561672-24561694 GAGGGTGGCGGGATAGGAGAGGG + Intronic
1080347401 11:31340357-31340379 GAGGGAGGGAGGAAAGGAGAAGG + Intronic
1081693401 11:45093600-45093622 GATGGTGGCAGCAATGGAGGTGG - Intergenic
1081786853 11:45753810-45753832 GAGGGTGGACGGAGGGGAGAGGG + Intergenic
1083387284 11:62320962-62320984 GCTGGTGGCAGGAATGGAGTGGG + Intergenic
1084290373 11:68161732-68161754 GAGGGTGCCAGGGATGGAGAAGG - Intronic
1084434820 11:69132552-69132574 CAGGGAGGCTGGAATGGAGTTGG - Intergenic
1084765891 11:71308112-71308134 GAGGATGCCAGGAATGGGGATGG + Intergenic
1085454635 11:76658849-76658871 GAGAGTGCCAGGAAGGGAGAGGG + Exonic
1086001851 11:81993082-81993104 TAGGGGAGCCGGAAGGGAGATGG - Intergenic
1086073591 11:82825650-82825672 GAGGGAGGGAGGAAAGGAGAAGG + Intronic
1086265511 11:84993262-84993284 GAGGGTGGGGGGCAAGGAGAGGG + Intronic
1086930072 11:92683181-92683203 GAGGATGACAGGAATGGAGTGGG + Intronic
1087078167 11:94144690-94144712 GAGGCTGGGTGGAGTGGAGAAGG - Intronic
1087237060 11:95731785-95731807 GAGGGTGGCAGCAGTAGAGATGG - Intergenic
1087762057 11:102111471-102111493 GAGGTTGGCGGGAGTGGAGGAGG + Intronic
1088950864 11:114568539-114568561 GAGGGAGGAAGGAAGGGAGAGGG - Intergenic
1088971623 11:114779431-114779453 GAGGGAGGCCGAAATGGGAATGG + Intergenic
1089295272 11:117463641-117463663 CAGGGTGGGAGGGATGGAGAGGG + Intronic
1090620179 11:128553677-128553699 GAGGGTGGCGGGAGTGTGGAGGG - Intronic
1090990491 11:131812759-131812781 AAGGGAGGCCGAAGTGGAGAGGG + Intronic
1091041250 11:132283981-132284003 GAGGGAGGAAGGAAGGGAGAGGG - Intronic
1091752805 12:3033166-3033188 CAGGGAGGCTGGACTGGAGACGG - Intronic
1093066879 12:14667444-14667466 GAGGGAGGGGGGAATGAAGATGG - Intronic
1094058802 12:26291982-26292004 TAGGATGGCAGGAATGTAGATGG + Intronic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1094498862 12:31006022-31006044 GGGTGTGGCAGGAAGGGAGAGGG + Intergenic
1095649833 12:44594140-44594162 GGGGGTGGCGGGATAGGAGAGGG + Intronic
1096482508 12:51951853-51951875 GGCGGGGGCCGGGATGGAGAGGG + Intronic
1096981882 12:55732800-55732822 GAGGGTGGGAGGCATGGGGAAGG + Intergenic
1098199669 12:68041373-68041395 GAGGGTGGGAGCAGTGGAGATGG - Intergenic
1100318163 12:93464895-93464917 GAGGGTGGTGGCAGTGGAGATGG - Intergenic
1100445689 12:94657474-94657496 TAGGGTGGCTGGAATGGTGGGGG + Intergenic
1102291391 12:111703233-111703255 GAGGGTGGCAGGCCTGGAAAGGG - Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102843181 12:116148075-116148097 GAGGGGGGCGGGAGTGGAGGGGG + Intronic
1103946744 12:124531468-124531490 GAGGGTGGCCTGTGGGGAGAAGG + Intronic
1104498555 12:129263634-129263656 GAGGGAGGGAGGAAGGGAGAAGG + Intronic
1104670274 12:130675522-130675544 GGGGGTGGACGGAAGGGAGTGGG - Intronic
1105949595 13:25217753-25217775 GAGGGAGGCCGGCAGAGAGAAGG + Intergenic
1107548773 13:41457050-41457072 GTGGGCGGGCGGAGTGGAGAGGG - Intergenic
1108436463 13:50405991-50406013 GAGGGAGGCAGGAAAGGAAAGGG - Intronic
1108599402 13:51978882-51978904 GGGGGTGGCCTGAATGGGGCTGG + Intronic
1109114011 13:58357803-58357825 AAGGGTGGAGGGAGTGGAGATGG - Intergenic
1109339957 13:61043340-61043362 TAGGGTGGTGGTAATGGAGATGG + Intergenic
1111876958 13:93909866-93909888 GAGGGAGGCAGGAAGGGAGAAGG - Intronic
1112709618 13:102112347-102112369 GGGGGTGGCAGGTGTGGAGAAGG - Intronic
1113864599 13:113512719-113512741 GAAGGGGGCCGGAGTGTAGACGG + Intronic
1114648185 14:24267214-24267236 GAGTTTGGCAGGAATGGAGGTGG + Intronic
1114722161 14:24894158-24894180 GAGGATTGCCTGAATGGAAATGG + Intronic
1115122198 14:29951053-29951075 GAGGGTGGTGGGAGTGGGGAGGG - Intronic
1115282235 14:31677314-31677336 GGGGGTGGAGGGAATGGGGATGG - Intronic
1116877204 14:50123837-50123859 CAGGGTGGCAGCAGTGGAGATGG + Intronic
1119722947 14:76903578-76903600 GAAGGAAGCAGGAATGGAGATGG - Intergenic
1121104313 14:91270899-91270921 AAGGGTCGCCGGCATGCAGAGGG + Intergenic
1121231037 14:92358617-92358639 GAAGATGGCAGGTATGGAGAGGG - Intronic
1121917070 14:97844808-97844830 GAGGGAGGGAGGAAGGGAGAAGG + Intergenic
1122250657 14:100437143-100437165 GAGAGTGGCAGGAAAGGAGGAGG + Intronic
1122302378 14:100738528-100738550 GTGGGTGGCCTGGATGGAGCTGG + Intergenic
1122829533 14:104389067-104389089 GAGGGTGGCCGGCACGGTGTGGG + Intergenic
1122835080 14:104426925-104426947 GAGGGTGGGCGGGGAGGAGAGGG - Intergenic
1122859834 14:104577581-104577603 GAAGGTGGCCGGGGTGGAGTAGG - Intronic
1124563879 15:30797901-30797923 GTGGGTGGATGGAAGGGAGAGGG + Intergenic
1124616651 15:31247089-31247111 GAGGTTGTACGGAAAGGAGAAGG - Intergenic
1124687158 15:31792410-31792432 GAGGGCGGCAGGACTGGAGCAGG - Intronic
1125249137 15:37679232-37679254 GGGGGTGGGGGGAGTGGAGAGGG + Intergenic
1125286112 15:38094169-38094191 TAGGGAGGCCTGAATGGAAAGGG - Intergenic
1125464873 15:39941071-39941093 GAGGGTGCCAGGCCTGGAGAGGG - Intronic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1127494074 15:59493154-59493176 GAGGGTGGTCTGCATGGAGTCGG + Intronic
1127818209 15:62631607-62631629 GAGGGAGGAGGGAAGGGAGAGGG - Intronic
1128582906 15:68821140-68821162 GGGGGTGGGCGGAATGGCGGGGG + Intronic
1130137380 15:81192802-81192824 GAGGGTGGCGGCAGTGAAGATGG + Intronic
1131250546 15:90827344-90827366 GTGGGAGGCGGGAAAGGAGAAGG + Intergenic
1131272770 15:90957072-90957094 CAGGGTGGCCAGAATGGAGGCGG - Intronic
1131465563 15:92652599-92652621 GAGGGAGGACAGACTGGAGAGGG + Intronic
1131866939 15:96721384-96721406 GTGGGAGGCAGGGATGGAGAGGG + Intergenic
1132321838 15:100930988-100931010 AAGGGTGGCCTGAATAGTGAAGG - Intronic
1132574878 16:659712-659734 GAGGCTGGCAGGGCTGGAGACGG + Intronic
1132618021 16:851915-851937 GAGGCTGGCCGAGATGGGGAGGG + Intergenic
1132765839 16:1533807-1533829 CAGGGTGGCCGGTGTGGAGCGGG - Exonic
1135297428 16:21294493-21294515 GGGGGTGGCGGGGAAGGAGAGGG - Intronic
1135433601 16:22408813-22408835 GAGGGAGGCAGGAATGGGGAAGG + Intronic
1135547825 16:23377629-23377651 GAGGGAGGAAGGAAGGGAGAAGG - Intronic
1136142809 16:28298185-28298207 GAGGGTGGCTGGGGAGGAGAGGG - Intronic
1136380003 16:29888802-29888824 AAGGTTGGCCTGAAAGGAGAGGG - Intronic
1136498786 16:30659506-30659528 GAGGGCGGTCGCCATGGAGACGG + Exonic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1137017525 16:35392741-35392763 GAGTGTGGCCTGAATGTGGAAGG - Intergenic
1137401460 16:48157002-48157024 GAGGGAGGTGGAAATGGAGAGGG + Intergenic
1137487127 16:48900830-48900852 GAGGGTGACTAAAATGGAGAAGG - Intergenic
1137556998 16:49477140-49477162 GAGGGTGAGCGGAAGGGGGAGGG + Intergenic
1137776672 16:51060735-51060757 GAGGGAGGGAGGAAGGGAGAAGG + Intergenic
1138049459 16:53761033-53761055 GAGGGAGGGAGGAAGGGAGAAGG - Intronic
1138606535 16:58093744-58093766 GAGGGTGGGAGGAAAGGAGGAGG - Intergenic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1138731216 16:59197146-59197168 GTGGGGGGGGGGAATGGAGAGGG - Intergenic
1138821965 16:60271511-60271533 GAGGGTGGAGGGAAAAGAGAAGG - Intergenic
1139124852 16:64065628-64065650 GAGGGAGGGGGGAATGGAGGGGG + Intergenic
1139235051 16:65329085-65329107 GATGGTGGCAGCAATGCAGAGGG + Intergenic
1139964474 16:70737898-70737920 GAGGGAGGCCGGAGTGGAGCAGG - Intronic
1140389464 16:74572602-74572624 GAGAGTGGCCTGCCTGGAGAGGG + Intronic
1140571499 16:76111849-76111871 GAGGGAGGGGGGAAGGGAGAGGG - Intergenic
1140799912 16:78476913-78476935 GAGGAAGGACGGAAAGGAGAAGG - Intronic
1141421582 16:83921221-83921243 GAGGGTGGATGGAAGGAAGATGG + Exonic
1141700138 16:85638698-85638720 GGGGGTGGCAAGAATGGGGAAGG - Intronic
1142030162 16:87834620-87834642 GAGGGAGGCTGGACAGGAGAGGG - Intronic
1142741696 17:1935276-1935298 GAGGGTGAGCGAGATGGAGAAGG - Exonic
1142928331 17:3260367-3260389 GAGGGAGGCAGGAAGAGAGAGGG - Intergenic
1142941464 17:3383040-3383062 GAGAGTGACCAGAATGGAAAAGG + Intergenic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143709147 17:8721900-8721922 CAGGGTAGCTGGAATGAAGAGGG - Intergenic
1145392023 17:22462416-22462438 GAGGGTTGCTGGAGTGAAGAAGG - Intergenic
1146943663 17:36860161-36860183 GAGGGTGGTAGGAGTGGACAGGG + Intergenic
1147360454 17:39926901-39926923 GGGGGTGGGCGGAATGGACATGG - Intronic
1147692419 17:42324674-42324696 GCGGGTGGGCGGGAGGGAGAAGG + Intronic
1148104650 17:45112833-45112855 GAGGCTGGTGGGGATGGAGAGGG - Intronic
1148603201 17:48909077-48909099 GAGGGTGGCCGGAATGGAGACGG - Intronic
1149498175 17:57132360-57132382 GAGGGTGGGCGGGCTGGAGGGGG + Intergenic
1149498211 17:57132456-57132478 GAGGGTGGGCGGGCTGGAGGGGG + Intergenic
1150007568 17:61479266-61479288 GGGGGTGGCCGGGCTGGGGAGGG - Intronic
1150133204 17:62680306-62680328 GAGGTTGGCCGGAGTGGCGCTGG + Exonic
1150263720 17:63818087-63818109 GATGGTGGTCGCCATGGAGATGG + Exonic
1150370244 17:64631239-64631261 GAGGGAGGGAGGAATGGAGGTGG + Intronic
1150433785 17:65139065-65139087 GAGGGGAGCTGGAATGGAGGAGG - Intronic
1151566409 17:74901000-74901022 GAGGGTGGCATGAATGGAAGAGG - Intergenic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152592895 17:81222486-81222508 GAGGGTGGAGGGGATGGAGGTGG + Intronic
1152599330 17:81253724-81253746 GATGGTGGTAGGGATGGAGATGG - Intronic
1152599339 17:81253775-81253797 GATGGTGGTAGGGATGGAGATGG - Intronic
1152599351 17:81253847-81253869 GATGGTGGTAGGGATGGAGATGG - Intronic
1152599372 17:81253961-81253983 GATGGTGGTGGGGATGGAGATGG - Intronic
1152659356 17:81535294-81535316 GGGGGTGGTGGGGATGGAGATGG - Intronic
1152659409 17:81535453-81535475 GGGGGTGGTGGGGATGGAGATGG - Intronic
1152725143 17:81941451-81941473 CAGGGTGGCCAGCATGGCGAAGG + Exonic
1153005008 18:490242-490264 GGGGGTGGCCGGAATGGCTGAGG - Intronic
1153523834 18:5977130-5977152 GAGGCTGGCCTGAGTGCAGAGGG - Intronic
1154156670 18:11949192-11949214 GGGGGTGGCAGGAAGAGAGAGGG - Intergenic
1157125146 18:44949856-44949878 AAGGGTGGGTGGAGTGGAGAGGG - Intronic
1157592319 18:48843192-48843214 GAGGGTGGCCTCAGTGGGGAGGG + Intronic
1157687249 18:49652234-49652256 CAGGGTCTCCTGAATGGAGAGGG - Intergenic
1157754544 18:50206238-50206260 GAGGGTGGCACCACTGGAGATGG - Intergenic
1158425494 18:57336602-57336624 GAGGCAGTCCAGAATGGAGAGGG + Intergenic
1160048119 18:75406659-75406681 GCGGGCGGCAGGGATGGAGAAGG + Intergenic
1160095065 18:75863705-75863727 GATGGTGGCAGGGATGGCGATGG - Intergenic
1160778351 19:866882-866904 GTGGGTGGACGGAGAGGAGATGG - Intergenic
1160778366 19:866933-866955 GTGGGTGGACGGAGAGGAGATGG - Intergenic
1161016335 19:1985577-1985599 GGGCGTGGCCGGAGTGGGGAGGG + Exonic
1161118174 19:2511084-2511106 GAGGGTGGACGGGATGGTGTGGG + Intergenic
1161484754 19:4529294-4529316 TAGGGTGGCAGAAATGGAGCTGG - Exonic
1161615264 19:5266705-5266727 GAGGGTGGCCGGACCACAGAAGG - Intronic
1161768038 19:6217497-6217519 CAGGGTGGCCTGCCTGGAGAGGG + Intronic
1162161925 19:8724594-8724616 GAGGATGGTGGGAATGGAGGTGG - Intergenic
1162403753 19:10461418-10461440 GAGGCTGGCCGGGCTGGGGAGGG + Intronic
1162793438 19:13074611-13074633 GAGGGTGGGGTGGATGGAGAGGG + Intronic
1163203766 19:15787496-15787518 GAGGGAGGCAGGAATGGAGAGGG + Intergenic
1163497905 19:17657248-17657270 CAGCGTGGCCGGAATGGAGGAGG - Intronic
1163677250 19:18661256-18661278 GAGGGTGCCCGGAACCCAGAAGG - Intronic
1163830646 19:19545679-19545701 TAGGGGGGCCAGCATGGAGAAGG - Exonic
1164441683 19:28284427-28284449 GAGGGTGGAAGGGAAGGAGAGGG + Intergenic
1164831154 19:31321971-31321993 GGGGGTAGGGGGAATGGAGAAGG - Intronic
1165778337 19:38417925-38417947 GAAGGTGTCCGGAAAGGAGGGGG + Intronic
1166102192 19:40577310-40577332 GAGGGTAGGAGGGATGGAGAGGG + Intronic
1166230262 19:41422418-41422440 GAAGGTGGCAGGATTGGGGAGGG - Intronic
1166231578 19:41428013-41428035 GAAGGTGGCCAGGAGGGAGAGGG + Intronic
1166525011 19:43505059-43505081 AAGGAAGGCAGGAATGGAGATGG + Intergenic
1166730820 19:45058060-45058082 GAGGAAGGCCGGAACGGAGGAGG - Intronic
1167069250 19:47210296-47210318 AATGGTGGCAGGAATGGTGAGGG - Intronic
1167768485 19:51499676-51499698 CAGGGTCCCCGGGATGGAGAAGG + Exonic
1168025424 19:53640248-53640270 GAGGGAGACAGGAAGGGAGAGGG + Intergenic
1168471230 19:56642818-56642840 CGGGGTGGGCGGAAGGGAGAAGG - Intergenic
926316204 2:11712089-11712111 GAGTGAGGCCGGCATGGCGAAGG - Intronic
927129935 2:20050703-20050725 GTAGGTGGCCAGGATGGAGAGGG + Intronic
927188217 2:20497619-20497641 GAGAGTGGAGGGAATGGAAAGGG + Intergenic
927194766 2:20539753-20539775 AAGGGTGCCAGGTATGGAGAGGG - Intergenic
927765452 2:25803197-25803219 GAGGGTGGCAAGCCTGGAGAGGG + Intronic
928644627 2:33339048-33339070 GAGGGAGGCAAGACTGGAGATGG + Intronic
928656396 2:33456042-33456064 GAGGGTGGGAGAAATGGAAAGGG - Intronic
929171104 2:38934392-38934414 CAGGGTGGCTTGAATGCAGAGGG - Intronic
929370383 2:41216570-41216592 GAGTGGGGCAGGAATGAAGAGGG - Intergenic
931226860 2:60339321-60339343 CAGTGTGGCTGGAATGGTGAGGG - Intergenic
931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG + Intronic
931882648 2:66582867-66582889 GAGGGCGGCCGAGAGGGAGAGGG - Intergenic
932049937 2:68388305-68388327 GAGGGGAGGGGGAATGGAGATGG + Intronic
932091117 2:68807374-68807396 GAGCACGGCCGGAATGAAGAGGG + Exonic
932304963 2:70695487-70695509 GAGGGAGGAGGGAGTGGAGATGG - Intronic
933567999 2:83974840-83974862 GAGGGTGGGAGGAAAGGGGAGGG + Intergenic
933831179 2:86210296-86210318 GAGGGTGGCGGGGAGGGGGATGG - Intronic
934511319 2:94946667-94946689 GAGGGTGGCGAGAAGGGAGCAGG - Intergenic
935260944 2:101355641-101355663 GAGGGTGGAGGAAATTGAGACGG + Intronic
935696236 2:105773311-105773333 GCGGGTGGCTGGAAAGGAGAGGG - Intronic
935719997 2:105971652-105971674 GAGGGTGGCGGGAATGTAGTTGG + Intergenic
936022103 2:109002625-109002647 GAGGGTGGCCGGGGAGCAGAGGG - Intergenic
936639886 2:114300331-114300353 GAGGGTGGCGGGATAGGGGAGGG - Intergenic
937740751 2:125350233-125350255 GAGGGTGGTGGGCAAGGAGAGGG - Intergenic
938938707 2:136149718-136149740 GAGGGTGGGGGGAATCTAGAAGG + Intergenic
939256369 2:139749189-139749211 GAGGGTGGAAGGAATGTAGAGGG - Intergenic
939289389 2:140174023-140174045 TAACGTGGCAGGAATGGAGAAGG + Intergenic
939560770 2:143728779-143728801 GAGGGCGGCAGTAATGGAGAGGG - Intronic
940406843 2:153313545-153313567 GAGGGTGGCGGGGTGGGAGAAGG + Intergenic
940919038 2:159287139-159287161 CAGGGTGGCCGAAATAGAGAAGG - Intergenic
942221165 2:173770395-173770417 GAGGGTGGCATGCCTGGAGATGG - Intergenic
945136944 2:206639624-206639646 AAGGGTGGCAGCAGTGGAGAGGG - Intergenic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
948766056 2:240219693-240219715 GGTGTTGGCAGGAATGGAGACGG - Intergenic
948802705 2:240440082-240440104 GAAGGTGGCCAGGAGGGAGAAGG + Intronic
948807118 2:240457806-240457828 CAGGGTGGCTGGAATGCAGCAGG - Intronic
948923445 2:241078633-241078655 GAGGGTGGAGGGGATGGGGAAGG + Intronic
1168749649 20:273409-273431 GAGAGTGGCGGGAAGGGAGCAGG - Intronic
1169207091 20:3746662-3746684 GAGGGAGGCGGGACAGGAGAAGG + Intronic
1169217852 20:3803753-3803775 GAGGGTGGCAGTAATGGATGTGG - Intronic
1169235381 20:3926038-3926060 GTGGGTGGCCAGAATGGAGAGGG + Intronic
1169273475 20:4217828-4217850 GAGGGAGGGCAGACTGGAGATGG + Intergenic
1170405549 20:16032252-16032274 GAGGGTGGAGGGAGTGGAGTGGG + Intronic
1170438012 20:16350291-16350313 GAGCGTAGCCGGAATGCAGAAGG + Intronic
1170515413 20:17124452-17124474 GAGGGTGGCAGGGATAGTGAGGG + Intergenic
1171386383 20:24771967-24771989 CCGGCTGGCCGGAATGGAGCTGG + Intergenic
1171433843 20:25104245-25104267 GAGGGTGGAGGGAATGGGAAAGG + Intergenic
1171469495 20:25358735-25358757 GGGGGTGGCCGATATGGACAAGG - Intronic
1171944755 20:31366728-31366750 GGTGGTGGTGGGAATGGAGAAGG - Intergenic
1172426667 20:34860285-34860307 GGGGGTTCCCGGAATGGTGAAGG - Exonic
1172622711 20:36330307-36330329 GGGGGCGGCAGGACTGGAGAAGG + Intronic
1172943466 20:38670662-38670684 GAGAGTGGCTGGCAGGGAGAAGG - Intergenic
1172945058 20:38680912-38680934 GAGGGAGGGTGGAAGGGAGAAGG - Intergenic
1173438840 20:43057294-43057316 GAGGGGGGAAGGAATGGAGGAGG + Intronic
1175157938 20:56985872-56985894 GAGGGAGGGTGGAATGGAGGTGG - Intergenic
1175238094 20:57526629-57526651 GGGGGTGGAGGGAATGGATAAGG + Intergenic
1175334532 20:58186451-58186473 GAGGGTGGCTGGACAGCAGATGG + Intergenic
1175518746 20:59586106-59586128 GAGGGAGGCTTGGATGGAGAAGG - Intronic
1175743339 20:61435969-61435991 AAGTGTGGCCAGACTGGAGAAGG - Intronic
1175804268 20:61818781-61818803 GATGGTGGGCGGAAAGGAGCAGG + Intronic
1176028041 20:62996171-62996193 GAAGGTGGCCGGATGGGCGAGGG + Intergenic
1176897397 21:14397501-14397523 GAGGGAGGCAGGAATAGAAAAGG - Intergenic
1177648365 21:23928720-23928742 GAGGGTGGGGGGCAAGGAGAGGG + Intergenic
1178400186 21:32278816-32278838 GTCGGTGGCCGACATGGAGAGGG - Exonic
1179629599 21:42668238-42668260 GGGGATGGCAGGAATGGGGAGGG - Intronic
1180154428 21:45971193-45971215 GAGGGTGGCAGAACTGGTGATGG - Intergenic
1181521113 22:23449292-23449314 GGAGGTGGCGGGGATGGAGAAGG - Intergenic
1181735028 22:24874664-24874686 GATGGAGGCAGGAAGGGAGATGG + Intronic
1182756897 22:32687642-32687664 GAGGGAGGCGGGAGTGGAGCAGG - Intronic
1183080531 22:35452976-35452998 GAGGCTGGGAGGCATGGAGAGGG + Intergenic
1183382213 22:37495924-37495946 GAGGTTGGCACGAATGTAGAAGG + Exonic
1183434567 22:37786166-37786188 GAGGGAGGCCGAGAGGGAGAGGG - Intergenic
1183434573 22:37786184-37786206 GAGGGAGGCCGAGAGGGAGAGGG - Intergenic
1184026984 22:41865201-41865223 GAGGTTTGGGGGAATGGAGATGG + Intronic
1184682600 22:46080160-46080182 GAGGCTGGCCGGGCGGGAGAGGG - Intronic
1184770624 22:46594694-46594716 TAGGAGGGCCGGACTGGAGATGG + Intronic
950442201 3:13016561-13016583 GAGGCTGGCAGGAGTCGAGAGGG - Intronic
951080605 3:18445809-18445831 GAGGGTGGGATGAAGGGAGATGG - Intergenic
951421895 3:22496527-22496549 GAGGGTGGAGGAAAAGGAGAGGG - Intergenic
951611187 3:24494593-24494615 CAGGGTGGGCGGGATGGTGACGG - Intronic
953656896 3:44861603-44861625 CCGGGTGGCCGGGATGGAGACGG + Intronic
954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG + Intronic
954698466 3:52439829-52439851 CAGGGTGGCCAGGCTGGAGAGGG - Intronic
956681026 3:71780825-71780847 TAGGGTGGCAGGATTGGACAGGG - Intronic
959774132 3:110135812-110135834 GGGGGTGGGGGGAATGGAGGTGG + Intergenic
960588071 3:119339268-119339290 GAGGGTAGCAGTTATGGAGAAGG + Intronic
962041284 3:131709917-131709939 GAGGGTGGCGGGAAAGGACTGGG - Intronic
963686518 3:148441854-148441876 ACAGGTGGCTGGAATGGAGATGG - Intergenic
963767865 3:149356463-149356485 GATGGAGGCAGGAATGGAGCTGG + Intergenic
964390721 3:156194927-156194949 GGGGGTGGGGGGAAAGGAGAGGG - Intronic
965558503 3:170040024-170040046 GAGGGTGGGGGGAAAGGGGAGGG + Intronic
966744637 3:183263918-183263940 GAGGGTGGTGGAAATGGGGACGG - Intronic
968512395 4:1001339-1001361 GAGGCTGGCCTGCATGGAGATGG + Intronic
968870508 4:3239655-3239677 AAGGGTTGCAGGAATGGAGGTGG + Intronic
968896285 4:3405767-3405789 GAGAATGGGCGGAAGGGAGAGGG + Intronic
968923094 4:3532653-3532675 GAGGGTGGCCGGGTGGGAGCAGG + Intergenic
969335888 4:6510070-6510092 GAGTGGGGCAGGAATGGAGATGG - Intronic
970195064 4:13544361-13544383 GAGGATCGCCTGGATGGAGAAGG + Exonic
972554183 4:40164374-40164396 GATGGTAGTCGGAGTGGAGAAGG + Intergenic
972569112 4:40294718-40294740 GATGGAGGCAGAAATGGAGATGG - Intergenic
972569147 4:40294928-40294950 GATGGAGGCAGAAATGGAGATGG - Intergenic
972569200 4:40295252-40295274 GATGGAGGCAGAAATGGAGATGG - Intergenic
972569218 4:40295354-40295376 GATGGAGGCAGAAATGGAGATGG - Intergenic
972569268 4:40295630-40295652 GATGGAGGCAGAAATGGAGACGG - Intergenic
973191002 4:47385976-47385998 GAGGGTGGCATGCCTGGAGAGGG - Intronic
973832616 4:54776916-54776938 GAGTGTGGCTGGAATAGAGTGGG + Intergenic
974824494 4:67109902-67109924 GAGGGAGGAAGGAAGGGAGAAGG + Intergenic
974958546 4:68672883-68672905 GAGGGCGGCGAGAATGAAGAAGG - Intergenic
976126384 4:81837750-81837772 CAGGGTGGAGGGAATGGGGAAGG - Intronic
976221058 4:82757159-82757181 GAGAGTGACGGGAAAGGAGATGG - Intronic
976665639 4:87587956-87587978 GTGGGTGGGGGGAAAGGAGAGGG + Intergenic
977279892 4:95026735-95026757 GAGGGAGGCAGGGAGGGAGAAGG - Intronic
978128720 4:105168033-105168055 GAAGGTGGTTTGAATGGAGATGG - Intronic
981054789 4:140349734-140349756 GGTGGTGGCAGGGATGGAGAAGG - Intronic
981684140 4:147434500-147434522 GAGGGTGGCAGGGATGGGGGTGG - Intergenic
983696197 4:170534789-170534811 GAGTATGGCTGGAATGGATAAGG + Intergenic
984878470 4:184390164-184390186 GAAAGTGGCTGGAATGGAGATGG - Intronic
987446167 5:18022085-18022107 GAGGGGGGCCGGAGTGGGTAAGG - Intergenic
988502576 5:31795978-31796000 GAGGGTGGGAGGGATGGACAGGG - Intronic
989007061 5:36826812-36826834 GAGGGAGGGAGGAAGGGAGAGGG + Intergenic
989161283 5:38393973-38393995 AAGGGAGGCTGGAAAGGAGATGG + Intronic
989232752 5:39104541-39104563 GAGGGAGGCAGAAAAGGAGAAGG + Intergenic
989406377 5:41065679-41065701 GAAGGTGGGAGGAATGGTGAGGG - Intronic
991351086 5:65721788-65721810 GAGGGAGGACGGAAGGGAGGGGG - Intronic
991484356 5:67119199-67119221 GAGGGTGGGAGGAGTGGACAGGG + Intronic
991499270 5:67259913-67259935 CAGGGTGGTGGCAATGGAGATGG + Intergenic
994034226 5:95180290-95180312 CAGGGAGGTGGGAATGGAGAGGG - Intronic
996092427 5:119364035-119364057 GAGGGTGGCCTGCCTGGACAAGG - Intronic
997213488 5:132092067-132092089 GAGGGTAGCCAGAATGGCTATGG - Intergenic
998938156 5:147252731-147252753 GAGGGCTGCTAGAATGGAGATGG - Intronic
999954087 5:156681295-156681317 GAGAGGGGCCTGGATGGAGATGG - Intronic
1000151040 5:158501129-158501151 CTGAGTGGCAGGAATGGAGAGGG + Intergenic
1000757990 5:165184559-165184581 GAGGGTGGCCAGAAGAGTGAGGG - Intergenic
1001089389 5:168726342-168726364 GAGGGAGGCAGGGAGGGAGAGGG + Intronic
1001089396 5:168726360-168726382 GAGGGAGGCAGGGAGGGAGAGGG + Intronic
1001089447 5:168726494-168726516 GAGGGAGGCAGGGAGGGAGAGGG + Intronic
1001237456 5:170042275-170042297 GGAGGTGGAAGGAATGGAGATGG - Intronic
1001284932 5:170415983-170416005 GAGGGGAGCGGGATTGGAGAAGG + Intronic
1002315502 5:178340746-178340768 GAGGTGGGCGGGAATGGAGGTGG + Intronic
1003130063 6:3387844-3387866 GTGAGTGGCAGGAAAGGAGAAGG + Intronic
1004331951 6:14729569-14729591 GAAGGTGGCCTGAATGGGGACGG + Intergenic
1004543405 6:16573410-16573432 GAGGATGGCAGGAAAGGAAAAGG - Intronic
1004866300 6:19856581-19856603 GAGGGGGGCAGGAGTGGGGAAGG + Intergenic
1005640894 6:27795080-27795102 GTGTGTGGCAGGAATGGTGATGG + Intergenic
1005969318 6:30749043-30749065 GAGGGTAGCAGGAATGGGGATGG - Intergenic
1006384208 6:33720153-33720175 AAGGGTGACAGGAGTGGAGAAGG - Intergenic
1007121545 6:39386322-39386344 GATGGTGACTGGAATGGTGAGGG + Intronic
1007692327 6:43710582-43710604 GAGGGTGGAAGGAAAGGAGGAGG + Intergenic
1007722219 6:43891746-43891768 GAGGGTGGCAGGCATGGCGGAGG + Intergenic
1007751248 6:44073275-44073297 GAGCGTGCGCGGAGTGGAGAGGG + Intergenic
1012212080 6:96531608-96531630 CTGGGTGGTAGGAATGGAGAGGG + Intronic
1013866142 6:114698456-114698478 GAGAGTGGCCAGAATGCAGAAGG + Intergenic
1014411097 6:121122215-121122237 GAGGATGTCAGTAATGGAGACGG - Intronic
1015318419 6:131843848-131843870 GAGTGTGGAAGGAATAGAGAGGG - Intronic
1015938610 6:138426763-138426785 AAGGGTGGCCAGAGTGGACAGGG + Intronic
1016368978 6:143351731-143351753 GAGGGTGGAGGGAAAGGGGAGGG - Intergenic
1016532566 6:145075010-145075032 GAGGGAGGAAGGAAGGGAGAAGG + Intergenic
1016894876 6:149041792-149041814 AAGGGTGGTCAGCATGGAGAGGG - Intronic
1017650878 6:156581516-156581538 GAGGGAGGCAGGAGAGGAGAAGG - Intergenic
1017712507 6:157183056-157183078 GAGGGTTGCTGGAATGTAGCTGG + Intronic
1018544941 6:164925015-164925037 GAGGGTGCCTGGAAGGGAGGTGG + Intergenic
1018868077 6:167760700-167760722 GTGGGTGCCAGGAATGGAGTGGG - Intergenic
1019313457 7:373946-373968 GAGGGTGGGCAGGAGGGAGAGGG + Intergenic
1019375823 7:691421-691443 GAGGGTGGCTTTGATGGAGAGGG + Intronic
1019512337 7:1424022-1424044 GAGGGTGGGCGGGATGGGGCTGG - Intergenic
1019590226 7:1827186-1827208 GGAGGTGGCGGGGATGGAGAAGG + Intronic
1020786423 7:12578960-12578982 GTGAGTGGCAGGAATGGTGAAGG - Intronic
1021501271 7:21334910-21334932 GAAGATGGTAGGAATGGAGATGG + Intergenic
1022522822 7:31019089-31019111 GAGGGCGGCTGGAAGAGAGAAGG - Intergenic
1023732539 7:43205967-43205989 GAGGGTGTCCTGGATGGGGAGGG - Intronic
1023777398 7:43620874-43620896 GGCCGTGGCAGGAATGGAGAAGG + Intronic
1026112122 7:67466531-67466553 GAGGGAGGGAGGAAGGGAGAAGG - Intergenic
1026974337 7:74487952-74487974 GAGGGTGGTGGGACTAGAGATGG + Intronic
1026994657 7:74607624-74607646 GAGGGTGGCCCGAGGGGAGCAGG - Intergenic
1027357405 7:77371402-77371424 GATGGAGGACGGATTGGAGAAGG - Intronic
1029448855 7:100629456-100629478 TAGGGTTGCCGGAATTGTGATGG - Intronic
1029901394 7:104044065-104044087 GAGGGTGGAGGGAAGGAAGAGGG + Intergenic
1032702965 7:134398072-134398094 GAGGGTGGCCAGCTGGGAGATGG + Intergenic
1034347990 7:150398647-150398669 GGGGCTGGCAGGGATGGAGAGGG - Intronic
1034879827 7:154754976-154754998 GTGGGTGGGCGGAAAGAAGAGGG + Intronic
1035253687 7:157613121-157613143 GCGGGAGGCGGGACTGGAGACGG - Intronic
1037544118 8:19900852-19900874 AAGGGTGGAGGAAATGGAGATGG + Intergenic
1037618620 8:20543550-20543572 GAGTGTAGCAGGAATGGAGAAGG - Intergenic
1038152983 8:24958898-24958920 GAGGCTGCCCAGAAAGGAGAGGG + Intergenic
1038205282 8:25459121-25459143 GAGTGTGCGCGGACTGGAGAAGG + Exonic
1038497308 8:28012872-28012894 GAGGGAGGGAGGGATGGAGAAGG + Intergenic
1041011704 8:53549871-53549893 CAGCCTGGCCGGTATGGAGAAGG - Intergenic
1043480453 8:80647357-80647379 GAGGGTGGGAGGAGAGGAGACGG + Intronic
1044806018 8:96009199-96009221 GCTGGTGGCTGGTATGGAGATGG - Intergenic
1044869728 8:96607109-96607131 GAGGGTGGGGGGGATGGAGGGGG - Intronic
1045021126 8:98045346-98045368 GATGGTGGCCGCAAAGAAGACGG - Exonic
1046470860 8:114672194-114672216 GTGGGTGGAGGGAAAGGAGAGGG - Intergenic
1047210397 8:122835698-122835720 CAGGGTGGCAAGAATGGAGAAGG + Intronic
1048539690 8:135331432-135331454 GATGGTGGGTGTAATGGAGAAGG - Intergenic
1049212547 8:141393352-141393374 GAGGGGGGCCGGCGTGGTGATGG - Intronic
1049614813 8:143571507-143571529 GAGGGGAGCGGGAATGGATACGG + Intronic
1050429188 9:5544460-5544482 GAGGGTGGACTGGAGGGAGAAGG - Intronic
1050530047 9:6580783-6580805 GAGTGGGTCCTGAATGGAGAAGG - Intronic
1050956255 9:11665402-11665424 TAGGGTGGCAGGAAGGGGGAGGG - Intergenic
1051159669 9:14192580-14192602 GAGGGTGGGAAGAAAGGAGAAGG + Intronic
1051560468 9:18435764-18435786 GATGGTGGCAGGCAAGGAGAGGG + Intergenic
1053189518 9:36050452-36050474 TAGGGTGGCAGCAGTGGAGATGG - Intronic
1053654056 9:40197600-40197622 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1053904443 9:42826776-42826798 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1054366171 9:64343816-64343838 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1054530542 9:66178738-66178760 GAGGGTGGCGAGAAGGGAGCAGG - Intergenic
1054673801 9:67833546-67833568 GAGGGTGGCGAGAAGGGAGCAGG + Intergenic
1054984388 9:71244915-71244937 GAGGGTTGCCAGAATCCAGATGG + Intronic
1055350185 9:75378562-75378584 GAGGGTGGCAGGAGGGGGGAGGG + Intergenic
1056458373 9:86785294-86785316 GAAGGGGGCAGCAATGGAGAAGG - Intergenic
1057067798 9:92071999-92072021 GAGGGTGGTGGGATTGGAGATGG - Intronic
1057704979 9:97389718-97389740 GAGGGTGGAAGGACTGGACAGGG - Intergenic
1058944253 9:109841758-109841780 GAGGGTGGAGAGAAAGGAGAGGG + Intronic
1058944272 9:109841796-109841818 GAGGGTGGAGGGAAAGGGGAGGG + Intronic
1060704051 9:125781522-125781544 GAGGGTGACCGAGAGGGAGAGGG + Intronic
1060781385 9:126415890-126415912 AAGGGTGGCCTGACTGGGGAGGG + Intronic
1061104347 9:128517530-128517552 TAGGGTGGTAGCAATGGAGATGG + Intronic
1061133939 9:128722889-128722911 GAGGGAGGAAGGAATGGACAGGG + Intronic
1061205766 9:129162374-129162396 GAAGGTGGCAGGAAGGGAGAAGG + Intergenic
1061213811 9:129208743-129208765 GAGGCAGGCCGGACAGGAGAAGG - Intergenic
1061495412 9:130971100-130971122 GAGAGAGGAAGGAATGGAGAAGG + Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062372450 9:136247111-136247133 GAAGGTGACCCGAATGGAGAAGG + Intergenic
1062404684 9:136389820-136389842 GAGGGTGGCTGGAGTGAAGCTGG + Intronic
1062663667 9:137654667-137654689 GAGGTGGGCCAGACTGGAGAGGG + Intronic
1185642463 X:1596442-1596464 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642478 X:1596489-1596511 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642492 X:1596536-1596558 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642507 X:1596583-1596605 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642522 X:1596630-1596652 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642537 X:1596677-1596699 GAGGGTGGGAGGGATGGAGGAGG - Intronic
1185642552 X:1596724-1596746 GAGGGTGGGAGGGACGGAGAAGG - Intronic
1185642595 X:1596884-1596906 GAGGGTGGGAGGGACGGAGAAGG - Intronic
1185700644 X:2228054-2228076 GAGGGAGGGAGGAAGGGAGAGGG + Intronic
1190097487 X:47493322-47493344 GAGGGTGGCATGACTAGAGAGGG - Intergenic
1190708261 X:53048460-53048482 GAGGGAGGCAGGGAGGGAGAGGG - Intergenic
1191759682 X:64632926-64632948 TAGGGTGGGGGGAGTGGAGAGGG - Intergenic
1193682339 X:84538033-84538055 TAGGGTGGCGGGAAGGGGGAGGG + Intergenic
1194336475 X:92653641-92653663 GTGGGTGGGGGGAAAGGAGAGGG - Intergenic
1194421150 X:93673923-93673945 CAGGGTGGGCGGATGGGAGAAGG - Intergenic
1194887914 X:99340865-99340887 GAGGGTGGCTGGAGGGGAGGTGG - Intergenic
1195329784 X:103787576-103787598 GAGGGTGGGGGGAATGGGTAGGG - Intronic
1195616647 X:106917841-106917863 GATGGGTGCGGGAATGGAGAGGG - Intronic
1196300749 X:114047622-114047644 GAGGGTGGTGGGATTGGAGCTGG + Intergenic
1198773121 X:140151616-140151638 GAGGGTGGGGGGAAAGGGGAGGG - Intergenic
1199669136 X:150127530-150127552 GGGGGTAGCAGGAATGGGGAGGG - Intergenic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1200114966 X:153765948-153765970 GAGGGGTGCCAGACTGGAGATGG - Intronic
1200413982 Y:2889313-2889335 GAGGGAGGAAGGAAGGGAGATGG - Intronic
1201739509 Y:17308399-17308421 GAGGGTGGCAAGAAGGCAGATGG - Intergenic
1202368538 Y:24182756-24182778 GGGCGTGGCCGGGATGGAAATGG - Intergenic
1202502247 Y:25487361-25487383 GGGCGTGGCCGGGATGGAAATGG + Intergenic