ID: 1148605599

View in Genome Browser
Species Human (GRCh38)
Location 17:48926957-48926979
Sequence TCTCTCCAAAAGGGTCCTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148605599_1148605608 19 Left 1148605599 17:48926957-48926979 CCCACAGGACCCTTTTGGAGAGA 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1148605608 17:48926999-48927021 CCAGTCCCTCTTGATGCGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 92
1148605599_1148605609 20 Left 1148605599 17:48926957-48926979 CCCACAGGACCCTTTTGGAGAGA 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1148605609 17:48927000-48927022 CAGTCCCTCTTGATGCGCCTGGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148605599 Original CRISPR TCTCTCCAAAAGGGTCCTGT GGG (reversed) Exonic