ID: 1148605608

View in Genome Browser
Species Human (GRCh38)
Location 17:48926999-48927021
Sequence CCAGTCCCTCTTGATGCGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148605596_1148605608 25 Left 1148605596 17:48926951-48926973 CCTTTCCCCACAGGACCCTTTTG 0: 1
1: 0
2: 2
3: 21
4: 228
Right 1148605608 17:48926999-48927021 CCAGTCCCTCTTGATGCGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 92
1148605604_1148605608 10 Left 1148605604 17:48926966-48926988 CCCTTTTGGAGAGAAGCGGGGCC 0: 1
1: 0
2: 0
3: 7
4: 90
Right 1148605608 17:48926999-48927021 CCAGTCCCTCTTGATGCGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 92
1148605599_1148605608 19 Left 1148605599 17:48926957-48926979 CCCACAGGACCCTTTTGGAGAGA 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1148605608 17:48926999-48927021 CCAGTCCCTCTTGATGCGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 92
1148605598_1148605608 20 Left 1148605598 17:48926956-48926978 CCCCACAGGACCCTTTTGGAGAG 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1148605608 17:48926999-48927021 CCAGTCCCTCTTGATGCGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 92
1148605600_1148605608 18 Left 1148605600 17:48926958-48926980 CCACAGGACCCTTTTGGAGAGAA 0: 1
1: 0
2: 0
3: 12
4: 179
Right 1148605608 17:48926999-48927021 CCAGTCCCTCTTGATGCGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 92
1148605605_1148605608 9 Left 1148605605 17:48926967-48926989 CCTTTTGGAGAGAAGCGGGGCCA 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1148605608 17:48926999-48927021 CCAGTCCCTCTTGATGCGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148605608 Original CRISPR CCAGTCCCTCTTGATGCGCC TGG Exonic