ID: 1148609751

View in Genome Browser
Species Human (GRCh38)
Location 17:48956865-48956887
Sequence TGGCAAGATCGCTTAAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148609742_1148609751 18 Left 1148609742 17:48956824-48956846 CCTGTAGTCCCAACTTCTCCCAG No data
Right 1148609751 17:48956865-48956887 TGGCAAGATCGCTTAAGCCCAGG No data
1148609749_1148609751 -1 Left 1148609749 17:48956843-48956865 CCAGCTACTCGGGAGGCTGAAGT 0: 408
1: 13112
2: 148556
3: 308689
4: 212025
Right 1148609751 17:48956865-48956887 TGGCAAGATCGCTTAAGCCCAGG No data
1148609743_1148609751 10 Left 1148609743 17:48956832-48956854 CCCAACTTCTCCCAGCTACTCGG No data
Right 1148609751 17:48956865-48956887 TGGCAAGATCGCTTAAGCCCAGG No data
1148609745_1148609751 9 Left 1148609745 17:48956833-48956855 CCAACTTCTCCCAGCTACTCGGG No data
Right 1148609751 17:48956865-48956887 TGGCAAGATCGCTTAAGCCCAGG No data
1148609748_1148609751 0 Left 1148609748 17:48956842-48956864 CCCAGCTACTCGGGAGGCTGAAG 0: 3656
1: 114895
2: 296870
3: 222573
4: 121722
Right 1148609751 17:48956865-48956887 TGGCAAGATCGCTTAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148609751 Original CRISPR TGGCAAGATCGCTTAAGCCC AGG Intergenic
No off target data available for this crispr