ID: 1148616057

View in Genome Browser
Species Human (GRCh38)
Location 17:48999878-48999900
Sequence TGTGAGCTGGGGCTCTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148616050_1148616057 15 Left 1148616050 17:48999840-48999862 CCAGGGGACCATCTGGGGTGAGA 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1148616057 17:48999878-48999900 TGTGAGCTGGGGCTCTTTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 242
1148616046_1148616057 24 Left 1148616046 17:48999831-48999853 CCATTGTTACCAGGGGACCATCT 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1148616057 17:48999878-48999900 TGTGAGCTGGGGCTCTTTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 242
1148616051_1148616057 7 Left 1148616051 17:48999848-48999870 CCATCTGGGGTGAGAGCTTTGTG 0: 1
1: 0
2: 1
3: 15
4: 151
Right 1148616057 17:48999878-48999900 TGTGAGCTGGGGCTCTTTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 242
1148616045_1148616057 25 Left 1148616045 17:48999830-48999852 CCCATTGTTACCAGGGGACCATC 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1148616057 17:48999878-48999900 TGTGAGCTGGGGCTCTTTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148616057 Original CRISPR TGTGAGCTGGGGCTCTTTGG AGG Intronic
901078844 1:6572195-6572217 TGTGAGCTGGGGCACCTTCTAGG + Intronic
902919155 1:19656317-19656339 TTTGGGGTGGGGCTCTTTTGAGG + Intronic
903056559 1:20640226-20640248 TGTGAACTGGGCATTTTTGGGGG - Intronic
904290690 1:29484039-29484061 GGTGGGCTGGGGCTTCTTGGGGG + Intergenic
905518167 1:38577651-38577673 CCTGGGCTGGGGCTCCTTGGTGG - Intergenic
906519609 1:46459313-46459335 GGAGGGCTGGGGCTCTGTGGAGG - Intergenic
909099858 1:71336849-71336871 TGTGATCTTGGTCTCTTGGGTGG - Intergenic
910970069 1:92847132-92847154 TGTGAAGTGGGACTCTTTAGAGG - Intronic
911165856 1:94723819-94723841 AGTGAGCTAGGGCTCTGTGGAGG - Intergenic
911218245 1:95218873-95218895 TGTGTGTTGGGGAGCTTTGGGGG + Intronic
913443548 1:118925417-118925439 TGTGAACTGGGAGTATTTGGTGG - Intronic
914338957 1:146741943-146741965 TATGTTCTGTGGCTCTTTGGGGG + Intergenic
915228791 1:154430486-154430508 GGAGAGCTGGGGCTCCTCGGGGG - Exonic
916792456 1:168136519-168136541 GGAGAGCTGGAGCTCTTTGTGGG - Intronic
918048775 1:180956550-180956572 GGTGAGCTTGGGGTCTTGGGGGG - Intergenic
919628082 1:199932101-199932123 TGAGAGGTGGGGCACTTTGGAGG + Intergenic
920309603 1:205041289-205041311 TGGGAGCTGGGTCTCTGGGGAGG - Intergenic
921123276 1:212155111-212155133 TTTGAGATAGGGCTCTTAGGAGG + Intergenic
921386163 1:214572239-214572261 TGTGAGTTGAGGCTTTTTAGAGG + Intergenic
923185314 1:231567174-231567196 AGTGCGCTGGGGCTTTTTGAAGG + Intronic
923591860 1:235327409-235327431 CGTGGGCAGGGGCTCTGTGGCGG - Intronic
923654319 1:235902088-235902110 TGAAAGCAGGTGCTCTTTGGTGG + Intergenic
923956923 1:239032768-239032790 TGTGAGCTGGGACTTATTAGGGG + Intergenic
1063515097 10:6687820-6687842 TGTCCCATGGGGCTCTTTGGAGG + Intergenic
1064125180 10:12653266-12653288 TGTGAGGTGGGGCCTTTTAGAGG - Intronic
1065960199 10:30727839-30727861 TGACTGCTGGGGCTCCTTGGGGG - Intergenic
1070199422 10:74189026-74189048 TGGGAGCGGTGGCACTTTGGGGG - Intronic
1071279225 10:84084785-84084807 TGTTAACTGTGTCTCTTTGGAGG + Intergenic
1071570240 10:86692692-86692714 TGTCAGCTGGAGCCCTTTGCAGG - Intronic
1072176144 10:92923792-92923814 CATGAGGTGGGGATCTTTGGAGG + Intronic
1073457617 10:103647125-103647147 TGACAGCTGGGACTCATTGGGGG - Intronic
1074380938 10:112979900-112979922 AATGTGCTGGGGCTTTTTGGTGG - Intronic
1076586992 10:131556098-131556120 TGTGTGCTGTGCCTCTTTGAGGG - Intergenic
1077242741 11:1519282-1519304 TGTGTGCTGGGGGTGTGTGGAGG - Intergenic
1079923891 11:26468085-26468107 TGTGGGATGTGGCTCCTTGGTGG - Intronic
1081564680 11:44250668-44250690 TGTGATTTGGGCCTCTTTTGAGG + Intergenic
1082091076 11:48090352-48090374 TGTGAGCTGGGGGTCTGGGAGGG - Intronic
1083547553 11:63560258-63560280 GCTGAGCTGGGGCTCCTTGCAGG - Intronic
1088125184 11:106415774-106415796 TGTGAGCAGGAGCACTGTGGGGG + Intergenic
1088213127 11:107478396-107478418 TGTGAGCTGAGGCACTTTGAAGG - Intergenic
1088503223 11:110505230-110505252 TGTGAGCTGTGGATCATTGCTGG + Intergenic
1088724143 11:112619673-112619695 TCTGAGCTGGGCCATTTTGGTGG - Intergenic
1089469184 11:118707170-118707192 TGTGAGATGGGGCCTTTGGGAGG + Intergenic
1090764564 11:129865407-129865429 TGTGAGATGTGGCTATTAGGGGG - Intronic
1092285087 12:7124079-7124101 TGTGAGCTGGTGCTGTCTGGAGG + Exonic
1092298687 12:7224107-7224129 TGTGAGCTGTGGAGATTTGGGGG - Intergenic
1093205683 12:16246092-16246114 TTACAGCTGTGGCTCTTTGGTGG + Intronic
1093308050 12:17543988-17544010 GGTGTGCTGGGGCACTATGGTGG + Intergenic
1095132881 12:38564649-38564671 TGTGTGCTGGGCCTGATTGGGGG + Intergenic
1095236142 12:39798272-39798294 GCTGAGCTGAGGCTCTGTGGTGG - Intronic
1096023555 12:48342138-48342160 TGTGGGCCAGGGCTATTTGGGGG + Exonic
1097881876 12:64693907-64693929 TGTGATCAGGGGCTCTGTGAAGG + Intronic
1100424563 12:94472000-94472022 TATGTACTGTGGCTCTTTGGAGG + Intergenic
1102132607 12:110543995-110544017 TCTGAGCTTGGGCTCTACGGAGG + Intronic
1104374132 12:128249150-128249172 TGTGAGCTGGGGTTAGCTGGGGG + Intergenic
1106519653 13:30485419-30485441 GCTGAGCTGGTGCCCTTTGGGGG - Intronic
1106587769 13:31072185-31072207 AGTGAGATGGGGCCCATTGGTGG - Intergenic
1106786244 13:33110636-33110658 TGTTAGCTGTGGCTTTCTGGGGG + Intronic
1106808137 13:33332391-33332413 TGGGAGATGGGGCTTTTAGGAGG + Intronic
1108777754 13:53786577-53786599 TGTGAGTGGAAGCTCTTTGGAGG - Intergenic
1108948838 13:56061105-56061127 TGTCAGCTGGGACTCTTGGCTGG + Intergenic
1111416001 13:87944894-87944916 TGTGATCTGAGGATCTCTGGAGG + Intergenic
1113777408 13:112955704-112955726 TGAGCGCAGGGGCTCTTTTGGGG - Intronic
1115485611 14:33908701-33908723 TGGGAGCTGAGGCTGGTTGGTGG + Intergenic
1116065266 14:39974016-39974038 TGTAAGATGGGGCTTCTTGGTGG + Intergenic
1121461253 14:94080487-94080509 TGTCAGCTGTGGCTCTGCGGTGG + Intronic
1122289021 14:100669483-100669505 TGGGAGCTGGGGCTCTTCTTAGG + Intergenic
1122324606 14:100874903-100874925 TGTGGGCCGGGTCCCTTTGGAGG - Intergenic
1122929438 14:104926586-104926608 TCTGACCTGTGGCTCTCTGGAGG + Intronic
1123008549 14:105336066-105336088 TGGGAGCTGGGGGCCTGTGGCGG - Intronic
1123704543 15:22941548-22941570 TGTGTGGTGGGGGTCTTGGGAGG + Intronic
1123910170 15:24957944-24957966 TCTGTGCTAGGGCTTTTTGGAGG + Intronic
1124351321 15:28957689-28957711 GGTGAGCAGGGGCTCTGTGGTGG + Intronic
1124689793 15:31812268-31812290 GGTGAGCTGGGGGCCTGTGGAGG - Intronic
1125519309 15:40339335-40339357 TTTCAGCTGTGGCTCTTTGGTGG + Intronic
1125716768 15:41823853-41823875 TGAGAGATGGGCCTGTTTGGGGG + Exonic
1126321653 15:47430539-47430561 TGTGGGCTGGGTCTCCTGGGTGG + Intronic
1126466603 15:48966290-48966312 GATGAGCTGGGGATTTTTGGAGG + Intergenic
1127287925 15:57546835-57546857 TGTGACGTGGGGCTCTTTGCTGG + Intronic
1128316451 15:66662263-66662285 TGTTCGTTGGGGGTCTTTGGTGG - Intronic
1132405704 15:101540940-101540962 GGGGAGCTGGAGCTCTCTGGAGG + Intergenic
1132655702 16:1040940-1040962 TGTGAGCTGGGGGTCTGGGGAGG - Intergenic
1132655892 16:1041533-1041555 TGGGAGCTGGGGGTCTGGGGAGG - Intergenic
1132870423 16:2113308-2113330 TGTCAGCCTGGGCTCTGTGGAGG + Intronic
1133013208 16:2926038-2926060 TGTGGGGTGGGGCTTTTTTGGGG - Intronic
1133211346 16:4264818-4264840 TTAAAGCTGGGGCTCTTTGGAGG + Intronic
1133734973 16:8607958-8607980 AGTGACCAGGGGCTCTGTGGGGG + Intergenic
1133859182 16:9577919-9577941 TCTGAGCTGAGCCTCTTGGGTGG + Intergenic
1134522117 16:14923617-14923639 TGTCAGCCTGGGCTCTGTGGAGG - Intronic
1134709786 16:16322268-16322290 TGTCAGCCTGGGCTCTGTGGAGG - Intergenic
1134717000 16:16362298-16362320 TGTCAGCCTGGGCTCTGTGGAGG - Intergenic
1134949817 16:18346377-18346399 TGTCAGCCTGGGCTCTGTGGAGG + Intergenic
1134957751 16:18389861-18389883 TGTCAGCCTGGGCTCTGTGGAGG + Intergenic
1135574061 16:23571485-23571507 TGGGAGCTGGGGCTGTTGAGCGG - Exonic
1136394460 16:29985578-29985600 GGTGAGCTAGGGCTGCTTGGGGG + Exonic
1136598069 16:31265569-31265591 TGTGTCCTGGGGATCTGTGGTGG + Intronic
1137879891 16:52035012-52035034 TGGGTCCTGGGGCTCCTTGGAGG - Intronic
1139995323 16:70975409-70975431 TATGTTCTGTGGCTCTTTGGGGG - Intronic
1141140810 16:81495691-81495713 TGTGGGCTGCTGCTCTTTGGAGG + Intronic
1141192486 16:81834623-81834645 TCAGAGCTGGGGCTCCTTGAGGG + Intronic
1141343318 16:83223408-83223430 TGGGAGGTGGGGCCCTTTAGAGG - Intronic
1141581017 16:84998713-84998735 TGAGAGCTGGAGCTCTGTTGGGG - Intronic
1141666450 16:85468071-85468093 GGTGGGCTGTGGCTCTTGGGAGG - Intergenic
1141687702 16:85579680-85579702 TCTGAGATGGGGCTCCTTGGAGG - Intergenic
1142315809 16:89344276-89344298 TGTTAGCTGAGGCTCGTTAGAGG - Intronic
1142495741 17:305422-305444 TGTGAGCTGGGCCTCCAGGGTGG - Intronic
1142811142 17:2396111-2396133 TGTGACGTGGGGCTCTTGTGAGG - Intronic
1143825498 17:9603035-9603057 TGTTACATGGAGCTCTTTGGAGG - Intronic
1143921062 17:10331342-10331364 TCTGAGATGTGGATCTTTGGAGG + Intronic
1144856349 17:18270489-18270511 TGTGAGCTGGTGGTCTAAGGTGG + Intergenic
1147841024 17:43371449-43371471 AGTCAGCTGAGGTTCTTTGGAGG + Intergenic
1148324599 17:46776009-46776031 TTTGTGCTGGGGCTATTTTGAGG - Intronic
1148616057 17:48999878-48999900 TGTGAGCTGGGGCTCTTTGGAGG + Intronic
1149268556 17:54953408-54953430 TGTAACCTGGGGCTCCTTGGGGG + Intronic
1150613242 17:66749959-66749981 GGTCAGCTGGGGCTGTCTGGGGG - Intronic
1151227114 17:72655712-72655734 TCTGATCTGGGGAGCTTTGGAGG + Intronic
1151436515 17:74100865-74100887 TGTGAGCTGGGGCTCATCAGAGG + Intergenic
1151966446 17:77434096-77434118 TGTGGGCTGGGGATCTGTGTTGG + Intronic
1152331029 17:79673153-79673175 TGGGAGCTGGGACATTTTGGGGG - Intergenic
1155079782 18:22397498-22397520 TGGGAGGTGGGACTCTTGGGAGG - Intergenic
1156000354 18:32378055-32378077 TGTGCGCGCGGGCGCTTTGGAGG + Intronic
1157324927 18:46662139-46662161 TCTGAGCTGGGGCTTTTAAGGGG - Intergenic
1160882422 19:1327259-1327281 TGTGAGCTGGGACTCCGAGGAGG + Intergenic
1161099650 19:2415382-2415404 TGTGGGCTGCGGGTCTGTGGTGG + Intronic
1161512581 19:4679725-4679747 TGTGACCAGGGGCTCCCTGGGGG - Intronic
1161658295 19:5529634-5529656 TTTGAGCAGTGGCTCTGTGGGGG + Intergenic
1161935884 19:7372003-7372025 TGTCAGCTGGGGATCTTTGCCGG - Intronic
1163690303 19:18735074-18735096 TGAGATCTGGGGCTCTTTGCTGG + Intronic
1167425701 19:49428697-49428719 TGTGGGCGGGGGCTGCTTGGTGG - Exonic
1168592300 19:57647355-57647377 CATGAGCTGGAGCTCTCTGGAGG + Intergenic
926214761 2:10898088-10898110 TGTGAGACAGAGCTCTTTGGGGG - Intergenic
928064743 2:28152140-28152162 TTTCAGATGTGGCTCTTTGGGGG - Intronic
929781360 2:44959275-44959297 TGTGGTCTGGGGCTCTCTGCTGG - Intergenic
930565469 2:53013922-53013944 TAGGAGTTGGGGCCCTTTGGGGG - Intergenic
930877408 2:56234316-56234338 GGAGAGCAGGGTCTCTTTGGAGG + Intronic
932896660 2:75646928-75646950 TGCGAGCTGGGGCGCGTTAGGGG + Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933663304 2:84944936-84944958 TGCGGGATGGAGCTCTTTGGTGG + Intergenic
934121680 2:88846164-88846186 TCTGAGGTGGGGCTGGTTGGGGG + Intergenic
935553980 2:104486670-104486692 TGAGAGCTGGGGATCTCTGGGGG - Intergenic
935874134 2:107488002-107488024 TGTGAGTTGGTGCTCTGTGCTGG - Intergenic
936009599 2:108916969-108916991 AGTGAGCTGCTGCCCTTTGGTGG - Intronic
937163255 2:119786581-119786603 TGTGACCTGGGCTTCCTTGGAGG + Intronic
940288669 2:152056964-152056986 TGGGAGGTGGAGATCTTTGGGGG - Intronic
940322185 2:152389415-152389437 TAGGAGATGGGGCTCTTGGGAGG - Intronic
941773051 2:169363713-169363735 TGTGAGAAGGGGCTGTTTGCGGG + Intergenic
942140978 2:172977414-172977436 TGTGATCAGGTGCTCTTTGAGGG + Intronic
942461064 2:176169336-176169358 TGTGGGCTGGGGCTCTCAGAGGG - Exonic
942507130 2:176654911-176654933 TTTGAGCTGGGGTTCTTTCGGGG + Intergenic
946160527 2:217833129-217833151 TGTGGGCTGGGGCTGCTTCGTGG - Intronic
946737802 2:222772287-222772309 TGTGAGCTGGGTCACTATGAAGG - Intergenic
1168957985 20:1848156-1848178 TGTGAGATGGAGGCCTTTGGAGG + Intergenic
1169263653 20:4154930-4154952 TGGGAGCTGGGGCTGTGTGAGGG + Intronic
1169620896 20:7505709-7505731 GGTGAGCTGAGGCCCTGTGGTGG - Intergenic
1169811167 20:9610808-9610830 TGTGAGGTGGGGCTGTCAGGAGG + Intronic
1170709930 20:18781478-18781500 TGTCAGCTAGTGATCTTTGGTGG + Intergenic
1170838786 20:19907261-19907283 TGAGAGGTGGGGCTTTTAGGAGG - Intronic
1172994986 20:39064147-39064169 CCTGTGCTGTGGCTCTTTGGAGG + Intergenic
1173689742 20:44951176-44951198 TGTGAGCTAGAGTTTTTTGGGGG + Intronic
1173856879 20:46255863-46255885 TGAGACCTGGGGCACGTTGGTGG + Intronic
1174821626 20:53731410-53731432 TAAGAGCTGGGGCCCTTGGGAGG + Intergenic
1174832932 20:53830135-53830157 TGTGTGCACGGGCTGTTTGGAGG + Intergenic
1174978572 20:55363737-55363759 GGGGACCTGGGGCACTTTGGAGG + Intergenic
1176121225 20:63455457-63455479 TGTGATCTGGGGCTGTCTGATGG - Intronic
1176389490 21:6156307-6156329 TGTGAGCTGGAGCCCATAGGAGG + Intergenic
1179276156 21:39893567-39893589 CATGAGCTGGGACTCTCTGGAGG - Intronic
1179420921 21:41236257-41236279 TGAGACCTGGGGCTCTCTAGGGG - Intronic
1179637359 21:42721772-42721794 TGAGAGCCAAGGCTCTTTGGAGG - Intronic
1179733978 21:43381931-43381953 TGTGAGCTGGAGCCCATAGGAGG - Intergenic
1183535951 22:38401592-38401614 TGCCAGCTGGGGCCCTTTGTTGG + Intergenic
1183831709 22:40421646-40421668 TGCCAGCTGGAGGTCTTTGGGGG - Intronic
950081885 3:10228424-10228446 TGTGGTTTGGGGCTGTTTGGGGG + Intronic
950161230 3:10762831-10762853 GCAGAGCTGGGGCTCTTTGCAGG - Intergenic
952265976 3:31786623-31786645 TAAGAGGTAGGGCTCTTTGGAGG - Intronic
952338628 3:32426483-32426505 TGTCAACTGTGACTCTTTGGGGG - Intronic
953276823 3:41508925-41508947 GGTGAGCTGGTGATCTTTTGGGG - Intronic
953608903 3:44431011-44431033 TGTGAGCTGTGGCTCTGAAGAGG + Intergenic
955701760 3:61688546-61688568 TCTGTTCTGGGGCTCTCTGGTGG + Intronic
956907920 3:73786152-73786174 TGTGTGCTGGGGATCTGTAGGGG + Intergenic
960961501 3:123073496-123073518 AGTGAACTGGAGCTCCTTGGGGG - Intronic
961432002 3:126890084-126890106 AGTGAGCTGGAGCACCTTGGGGG - Intronic
961470385 3:127107621-127107643 GGTGAGCAGGGGCTGTTTGTGGG + Intergenic
962480707 3:135795844-135795866 TGTAAACTACGGCTCTTTGGAGG + Intergenic
962681350 3:137803249-137803271 TGTGATCTGGATATCTTTGGGGG - Intergenic
965665589 3:171090288-171090310 AGTGAGCTGAGCCTCTTTGAAGG - Intronic
969302644 4:6306258-6306280 TGTCAGCTGTGTCTCTCTGGAGG - Intergenic
969905106 4:10386493-10386515 TGTGAGCTGGGGCTCTGATGTGG + Intergenic
970872767 4:20835074-20835096 TATTAGCTTGGGCTCTTTGATGG - Intronic
972764053 4:42135044-42135066 GGTGACCTGGGGCTGTTTGGGGG + Intronic
974656512 4:64830682-64830704 AGTGAGCTGTGGATCTTTGATGG - Intergenic
974927164 4:68313893-68313915 TGTCAGCTGTGGATTTTTGGCGG + Exonic
975785265 4:77880934-77880956 TGTAGCCTGGGGCTCTGTGGAGG + Intronic
979035602 4:115712750-115712772 TTTGAGGTGGGGCTGTTGGGAGG + Intergenic
979752876 4:124301103-124301125 TGGGAGCTGGGGCTCTGGTGTGG + Intergenic
979896666 4:126166424-126166446 TTTGGGGTGGGGCACTTTGGAGG - Intergenic
980379919 4:132000389-132000411 TGTGAGGTGAGGCTTTTGGGGGG + Intergenic
980722195 4:136713070-136713092 TGTGAGTTGAAGTTCTTTGGAGG + Intergenic
984808489 4:183773025-183773047 TGGGAGGTGGGGCTTTTGGGAGG - Intergenic
986609523 5:9552698-9552720 TATGAGGTGGGGCCTTTTGGAGG - Intergenic
989387370 5:40867032-40867054 TTTGTTCTGGGGCTCTTTGTTGG + Intergenic
989643359 5:43603840-43603862 TGTGAGTTGGGGCGGTCTGGCGG + Intronic
990547066 5:56833514-56833536 TGTGAGCTGAGGCACTGTGGGGG - Intronic
993494596 5:88593655-88593677 AGTGACCTTGGGCTCTTTGAGGG - Intergenic
995597609 5:113764635-113764657 TGTGAGCTCTGGCTCATGGGTGG - Intergenic
995712487 5:115049522-115049544 TGTGTGCAAAGGCTCTTTGGAGG - Intergenic
996228716 5:121034051-121034073 TGTCAGCTGGGGCCTTTTGCTGG - Intergenic
996804959 5:127444145-127444167 TAAGAGCTGTGGCTCTCTGGAGG - Intronic
996815076 5:127565524-127565546 TGTGAGGTGGGGCTGGCTGGAGG + Intergenic
1001066056 5:168535912-168535934 TGGGAGCAGGGTCTCTCTGGGGG + Intergenic
1001077032 5:168637660-168637682 TCTAAGCTGGGGCTCTCTGAAGG - Intergenic
1001593967 5:172886006-172886028 TGTCAGCTGGGGCTCGGTGATGG + Intronic
1002583856 5:180228920-180228942 TGTCAGCCAGGGCTGTTTGGTGG - Intergenic
1003957544 6:11178090-11178112 TGTGAGCTGAGTCACATTGGCGG + Intergenic
1004702035 6:18088269-18088291 GGTGAGCTGGGCCTCTTTCCAGG + Intergenic
1005344239 6:24873685-24873707 TTTAGGCTGAGGCTCTTTGGGGG + Exonic
1005782137 6:29203037-29203059 TGTGTGCTGGGCAGCTTTGGTGG - Intergenic
1006170496 6:32089199-32089221 TGAGAGCTGGGGCTGTGGGGAGG - Intronic
1007311552 6:40950342-40950364 TGGGAGATGGGGCTCATTGCTGG + Intergenic
1012260725 6:97084350-97084372 TGGAAGCTGTGGCTCTCTGGAGG + Intronic
1013018914 6:106190398-106190420 TGGGAGGTGAGGCTTTTTGGGGG - Intronic
1015093068 6:129382449-129382471 TGGGAGGTGGGGCTGTTTTGGGG + Intronic
1016602558 6:145879090-145879112 TATGAGCTGGGTCCCTTTGGTGG + Intronic
1019143701 6:169963376-169963398 CGTGAGCAGGGGCACTTGGGAGG + Intergenic
1019206517 6:170366282-170366304 TGAGAGCTGGGACTCATGGGTGG + Intronic
1019564224 7:1671601-1671623 TGCAAGCTGGACCTCTTTGGAGG - Intergenic
1021025245 7:15658644-15658666 TTTGAGTTGGGGCTTTTGGGAGG + Intronic
1021566971 7:22025696-22025718 GGTGAGCTGGTGGGCTTTGGTGG - Intergenic
1022055981 7:26734825-26734847 TAAGAGCTGGGGCTTTTGGGAGG - Intronic
1022762111 7:33365941-33365963 TGTGAGCTGGCTCACTCTGGTGG + Intronic
1023292488 7:38682947-38682969 TAGGAGGTGGGGGTCTTTGGGGG - Intergenic
1024942510 7:54777259-54777281 AGGGAGCCGGGGGTCTTTGGAGG - Intergenic
1027242788 7:76343760-76343782 TGTGAGCTGGGACTCGCTGCTGG + Intronic
1033636475 7:143216417-143216439 TGTGAGCTGGATCTCCTTGTAGG - Intergenic
1033650471 7:143338918-143338940 AATGGGCTGGGGCTCTTTTGGGG + Intronic
1035990776 8:4488003-4488025 TATGAGATGGGGCTTTCTGGAGG + Intronic
1036217236 8:6890864-6890886 TGTGAGTTGTGGCCATTTGGGGG - Intergenic
1038440731 8:27569330-27569352 TGTGAGCTGCCGCTCCTGGGAGG + Intergenic
1039612998 8:38933702-38933724 TGGGAGCTGGGGCTCCTATGTGG + Intronic
1039743700 8:40404969-40404991 TGTTTGCTGGGAGTCTTTGGTGG + Intergenic
1045788085 8:105947643-105947665 TTTGAGCTGTTGCTCTTTTGTGG - Intergenic
1046880618 8:119303201-119303223 TGAGAGATGGGGCTTTTAGGAGG - Intergenic
1047777996 8:128089477-128089499 TGGGAGGTGGGGCCTTTTGGGGG - Intergenic
1048008348 8:130437293-130437315 TGTGAGCTGGGGCATCTTGAAGG - Intronic
1048870101 8:138790335-138790357 TGGGAGGTGGGGCTCTTGGGAGG - Intronic
1049849609 8:144823717-144823739 TGCCAGCTGGGCATCTTTGGGGG - Intergenic
1050486814 9:6142998-6143020 TTCAAGCTGGGGCTCTTTGCTGG + Intergenic
1050758745 9:9039918-9039940 TGTCACCTGGGCCTGTTTGGAGG + Intronic
1050977587 9:11961032-11961054 TGAGATCTGGGGATCTTTGAGGG + Intergenic
1051593547 9:18800557-18800579 TGAAAGCTTGGGGTCTTTGGTGG - Intronic
1057151194 9:92797552-92797574 CTTGAGCTGGGGTTCGTTGGGGG + Intergenic
1057306489 9:93915337-93915359 TGGGAGCTGGGGCTCTGGGGTGG - Intergenic
1059142810 9:111870205-111870227 TTTGAGGTGGGGCTTTTGGGAGG + Intergenic
1059361912 9:113750717-113750739 TGGGAGCTGGGGCCCTTGGGAGG + Intergenic
1061406664 9:130396118-130396140 TGGGAGCTGTGGCTCTAAGGGGG - Intronic
1062392752 9:136340516-136340538 TGTGCGCCGAGGCTCTGTGGGGG - Intronic
1062673247 9:137723903-137723925 TCTGAGCTGGGGCTTTATGATGG - Intronic
1185938497 X:4285916-4285938 TCAGAGGTGGGGCTTTTTGGAGG + Intergenic
1189284383 X:39841044-39841066 TTGGAGCTGGGGCTGTTGGGCGG + Intergenic
1189995845 X:46636680-46636702 TCTGTGCTGTGGCACTTTGGAGG - Intronic
1190502392 X:51092550-51092572 TTTGAGATGGGGCTTTTGGGAGG - Intergenic
1191931643 X:66379931-66379953 TGTGAGTTGGGGCTGGGTGGAGG + Intergenic
1197366317 X:125568057-125568079 AGTGAGATGGGGCTTTTTGTTGG - Intergenic
1198180648 X:134205140-134205162 TAAGAGATGGGGCTTTTTGGAGG - Intergenic
1199574611 X:149301461-149301483 TGTCAGCAGGGTCTCTTTGGGGG - Intergenic
1200750396 Y:6939540-6939562 TGGGACATGGGGATCTTTGGGGG + Intronic
1200771051 Y:7125815-7125837 TGTTAGCTGAGGCTCATTAGAGG - Intergenic
1201746876 Y:17385870-17385892 TATGAGGTGGGGCCTTTTGGAGG + Intergenic
1202062726 Y:20904471-20904493 TGGGATCTGGGGCCTTTTGGTGG + Intergenic