ID: 1148617041

View in Genome Browser
Species Human (GRCh38)
Location 17:49008688-49008710
Sequence CATGGTTAGCAACTGTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148617034_1148617041 11 Left 1148617034 17:49008654-49008676 CCCAAACTCCTTTGCTCTCTTCT 0: 1
1: 0
2: 4
3: 53
4: 567
Right 1148617041 17:49008688-49008710 CATGGTTAGCAACTGTAGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 80
1148617035_1148617041 10 Left 1148617035 17:49008655-49008677 CCAAACTCCTTTGCTCTCTTCTC 0: 1
1: 0
2: 3
3: 83
4: 734
Right 1148617041 17:49008688-49008710 CATGGTTAGCAACTGTAGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 80
1148617036_1148617041 3 Left 1148617036 17:49008662-49008684 CCTTTGCTCTCTTCTCTTAAAAG 0: 1
1: 0
2: 3
3: 46
4: 435
Right 1148617041 17:49008688-49008710 CATGGTTAGCAACTGTAGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148617041 Original CRISPR CATGGTTAGCAACTGTAGCC TGG Intronic
902254835 1:15181519-15181541 GATGGTTAGGAACCGAAGCCTGG - Intronic
903608034 1:24589323-24589345 CTTGGTTAACAACTGTTGCTGGG + Intronic
905805515 1:40874219-40874241 GATGGTAAGCCACTGGAGCCAGG + Intergenic
906661955 1:47589329-47589351 CATGGTTACCAACTTCAGCTAGG + Intergenic
913677864 1:121158962-121158984 CATTGTTAGCAAGTGTCTCCAGG + Intergenic
914029698 1:143946591-143946613 CATTGTTAGCAAGTGTCTCCAGG + Intronic
914159751 1:145121359-145121381 CATTGTTAGCAAGTGTCTCCAGG - Intergenic
917490972 1:175498214-175498236 CATAGTAAGAAACTGTTGCCAGG + Intronic
918899550 1:190396367-190396389 CATCCTCAGTAACTGTAGCCAGG + Intronic
920465170 1:206177472-206177494 CATTGTTAGCAAGTGTCTCCAGG + Intergenic
921578989 1:216873812-216873834 CATTGTTAGCACTTGGAGCCTGG + Intronic
1062997808 10:1883309-1883331 CAGTGTCAGCCACTGTAGCCTGG - Intergenic
1063498185 10:6529222-6529244 CATGGTTAGAAAATGATGCCAGG - Intronic
1063989052 10:11539664-11539686 CTTTGTCAGCAACTGTAGGCGGG - Intronic
1067167079 10:43873886-43873908 CAAGGTTAGCAAGAGGAGCCCGG - Intergenic
1068724972 10:60290697-60290719 CATGGTTAGCATCTTTACACTGG + Intronic
1069353469 10:67557140-67557162 CAAGGTTAGCCATTGAAGCCTGG - Intronic
1070580056 10:77712103-77712125 GATGGTTAGGAACTCTTGCCTGG + Intergenic
1073756597 10:106587591-106587613 CAGTGGTAGCAACTGAAGCCTGG + Intronic
1077456074 11:2681682-2681704 CATGGGAAGCAACGGCAGCCTGG - Intronic
1078451119 11:11441719-11441741 CATGGTTAGCAACTCTGGGATGG + Intronic
1079242107 11:18728650-18728672 CATCGTTAAAAACTGGAGCCCGG + Exonic
1079418578 11:20264250-20264272 CATGGTCAAGAACTGTTGCCAGG - Intergenic
1080885578 11:36364684-36364706 CATCCTTAGCAAGTGTAGCCAGG + Intronic
1083487841 11:62994774-62994796 ATTGGTTAGCACCTGCAGCCAGG + Intronic
1085829533 11:79884816-79884838 TATGGTTGGCATCTGAAGCCTGG - Intergenic
1088954747 11:114607264-114607286 CATGGGTAACCACTGTTGCCTGG + Intergenic
1088955028 11:114609101-114609123 CATGGGTAGCTACTGTTACCCGG + Intergenic
1093484203 12:19635908-19635930 TATGGTCACCAACTGTGGCCTGG + Intronic
1096944729 12:55392184-55392206 CATGGATAGCTACTGTAGGCAGG - Intergenic
1101833016 12:108274087-108274109 CAAGGTTATCAACTGAAGTCAGG + Intergenic
1108706324 13:52991757-52991779 CAGGGTTAGTCATTGTAGCCTGG + Intergenic
1112369986 13:98785703-98785725 CTCGGTTAGCAACTCCAGCCAGG - Intergenic
1124702276 15:31926484-31926506 CATGGTTAGAAACCGAAGACAGG + Intergenic
1129338284 15:74867426-74867448 TATGGTTGGCACCTGGAGCCAGG - Intronic
1133834200 16:9351706-9351728 CATAATCAGCAACGGTAGCCAGG - Intergenic
1143192213 17:5048308-5048330 AATGGTTAGAAAATGTGGCCGGG - Intronic
1148617041 17:49008688-49008710 CATGGTTAGCAACTGTAGCCTGG + Intronic
1158102259 18:53842585-53842607 AATGGTTAGCAGGTGCAGCCAGG - Intergenic
1158704457 18:59779301-59779323 CACAGTCAGCAACTGTTGCCAGG + Intergenic
1163538529 19:17892770-17892792 GATGGGGAGCAACTTTAGCCAGG + Intronic
926711305 2:15883888-15883910 GATGGTTGGCCACTGTAGCTGGG - Intergenic
928164394 2:28959144-28959166 TCGGGTTAGCATCTGTAGCCCGG - Intronic
931366014 2:61619684-61619706 CAGGGTTTGCAACAGTTGCCTGG + Intergenic
946425777 2:219595580-219595602 CATGGGTAGCCCCTGTAGCCAGG - Intergenic
946748503 2:222869634-222869656 CATGTTTTGCCACAGTAGCCAGG + Intronic
948786418 2:240355099-240355121 CATCCTTAGCAAGTGCAGCCAGG - Intergenic
1168925110 20:1572860-1572882 CCTGGATAACAACTGAAGCCAGG + Intronic
1168928986 20:1605888-1605910 CCTGGATAACAACTGAAGCCAGG + Intronic
1172708044 20:36897351-36897373 CAGGGTTGGCAACTGTGGCTTGG + Intronic
1174048437 20:47750274-47750296 CATGGTTAGAAGCTGTGGGCCGG - Intronic
1174337888 20:49876250-49876272 CAGGGTCAGAATCTGTAGCCTGG - Intronic
1179975272 21:44861875-44861897 CATGGTCACCATCTGTAGCAAGG + Intronic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
954219172 3:49142299-49142321 CAAGGGTCACAACTGTAGCCTGG + Intergenic
956377632 3:68632604-68632626 CATGTTAAGAAACTGTTGCCTGG + Intergenic
966506870 3:180713832-180713854 GATGGTTGCCAACAGTAGCCAGG + Intronic
971308436 4:25503925-25503947 CATGTTTAGCAAAAGAAGCCAGG - Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
971555091 4:28003524-28003546 CATGGATAGCAAGAGTGGCCAGG - Intergenic
971732389 4:30401818-30401840 TGTAGTTAGCAATTGTAGCCTGG - Intergenic
988732304 5:33984562-33984584 CATGGGTAGCAACAGTGGGCAGG - Exonic
991443955 5:66680332-66680354 CAGGGTTAGCAACTGCTGCGTGG - Intronic
993513792 5:88804271-88804293 CATGGTTGGGAACTCTTGCCAGG - Intronic
994688862 5:102991170-102991192 GATGGGAAGCAACTGAAGCCTGG - Intronic
996591602 5:125154239-125154261 CCTGGTGAGCATATGTAGCCTGG - Intergenic
1001241901 5:170077670-170077692 GGTGGTTAGCAGCTGTAGCCTGG - Intronic
1006742221 6:36317295-36317317 AATGGTTCGCAGCTTTAGCCAGG - Exonic
1007280910 6:40711776-40711798 CATGGGTTGCAACTGTAAACAGG - Intergenic
1009961852 6:70532534-70532556 CATTTATAGCTACTGTAGCCGGG + Intronic
1011587204 6:88939800-88939822 CATGATTACCCACTGCAGCCTGG - Intronic
1015165796 6:130198835-130198857 CATGGGGTGCAACTGAAGCCTGG - Intronic
1021925264 7:25528434-25528456 CTGGGTGAGCAATTGTAGCCTGG - Intergenic
1032563020 7:132912300-132912322 TCTGGTTAGTAACTGTTGCCTGG + Intronic
1042874259 8:73426118-73426140 CATGTCTACAAACTGTAGCCTGG + Intronic
1047311673 8:123697474-123697496 AAAGGTTTGCACCTGTAGCCTGG + Intronic
1048340691 8:133536519-133536541 CATGGTGAACCACTGTGGCCAGG - Intronic
1050932528 9:11348576-11348598 CAAGGTTGGCAAATGCAGCCTGG - Intergenic
1057686487 9:97238918-97238940 CATGGTTGACAACTGTAGTTGGG + Intergenic
1059440402 9:114303533-114303555 CATGAAAAGCACCTGTAGCCCGG - Intronic
1061358510 9:130124642-130124664 CAGGGTCAGCAGCTGTAACCTGG - Intronic
1189558050 X:42165745-42165767 CATGCTTATCAGCTGTAGCAGGG + Intergenic
1190318794 X:49167227-49167249 CATGGTGAAGAACTGCAGCCGGG + Intronic
1193148389 X:78101054-78101076 CATGGTTGAGAACTGCAGCCTGG + Intronic
1194974096 X:100375748-100375770 CATGGTTATCACCAGTAGTCAGG - Intronic