ID: 1148617314

View in Genome Browser
Species Human (GRCh38)
Location 17:49010811-49010833
Sequence AGTCCACGCACTAAAATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148617306_1148617314 30 Left 1148617306 17:49010758-49010780 CCTCCAGCATTTTCACTTTAAAT 0: 1
1: 0
2: 2
3: 38
4: 380
Right 1148617314 17:49010811-49010833 AGTCCACGCACTAAAATGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1148617309_1148617314 7 Left 1148617309 17:49010781-49010803 CCAGGAAAAACTGAGAGTACAGA 0: 1
1: 1
2: 1
3: 20
4: 302
Right 1148617314 17:49010811-49010833 AGTCCACGCACTAAAATGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 39
1148617307_1148617314 27 Left 1148617307 17:49010761-49010783 CCAGCATTTTCACTTTAAATCCA 0: 1
1: 0
2: 0
3: 29
4: 298
Right 1148617314 17:49010811-49010833 AGTCCACGCACTAAAATGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148617314 Original CRISPR AGTCCACGCACTAAAATGGG AGG Intronic
905976768 1:42181195-42181217 TGGCCACTCACTAAACTGGGTGG + Intronic
1072486881 10:95864313-95864335 AGTCCAGGGACTAAAGTGAGTGG + Intronic
1074549139 10:114427058-114427080 AGTCCAGGCACTAAGAAGAGAGG - Intergenic
1080012073 11:27470382-27470404 AGTCTACTCACTAAAATGTGAGG + Intronic
1083734417 11:64671389-64671411 AGTCCAGACACAAAAATGGCAGG + Intronic
1089289320 11:117428425-117428447 GGCCCACACACCAAAATGGGGGG - Exonic
1091009668 11:131987763-131987785 AGTCCAAACACTCAAATGTGTGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1096705883 12:53421782-53421804 AGGCCACTAACTAAAAAGGGAGG - Intergenic
1104490193 12:129187292-129187314 AGGCCACACACAAAATTGGGAGG + Intronic
1120201275 14:81540566-81540588 AGTTCAAGCACTAAACTGGGTGG + Intergenic
1143408089 17:6691265-6691287 AGTCCATTCACCAAACTGGGAGG - Intronic
1148617314 17:49010811-49010833 AGTCCACGCACTAAAATGGGAGG + Intronic
1154005605 18:10525072-10525094 AGTATACGCACTAAAATGATGGG + Intergenic
1155311970 18:24532888-24532910 AGTCCTTGCACTACCATGGGAGG + Intergenic
1155784399 18:29879239-29879261 AGAACACGCACAAAAAAGGGGGG + Intergenic
1156073828 18:33247806-33247828 AGTCCACGCATTAAATGGAGTGG + Intronic
1158146253 18:54316530-54316552 AGTCCACAGAATAAAATGTGTGG + Intronic
942339294 2:174926481-174926503 AGTCAACAGAATAAAATGGGAGG - Intronic
947060666 2:226161282-226161304 AGCTCTCACACTAAAATGGGTGG - Intergenic
1179314053 21:40225541-40225563 AGTCCACACACAAAGAAGGGTGG - Intronic
963067682 3:141276619-141276641 TGCCCACGCACAAAAATGTGTGG - Intronic
963999172 3:151748171-151748193 AGTCTAAGCACTAATTTGGGAGG - Intronic
969204332 4:5631551-5631573 AGTTCACGCAGTAGACTGGGGGG + Intronic
977458873 4:97299461-97299483 AGTTCCCTCACTACAATGGGAGG - Intronic
977937490 4:102824033-102824055 TGTCCACTCACTAAAATTGTTGG + Intronic
989428946 5:41329541-41329563 AGTCCACAAACTAAAATCTGTGG - Intronic
990629439 5:57651678-57651700 AGCCCAAGCACTAGTATGGGTGG - Intergenic
1009912682 6:69951999-69952021 AGTTCACTCACTAAACTGGCAGG - Intronic
1010668352 6:78655923-78655945 ATTTCAAGCACAAAAATGGGTGG - Intergenic
1011054435 6:83191261-83191283 AGTCCTGGAGCTAAAATGGGAGG - Exonic
1013607398 6:111762862-111762884 AGTCCTCGCATTCAAATGGCTGG + Intronic
1013817906 6:114120861-114120883 ATTCCACGAATTAAAAAGGGAGG + Intronic
1014213442 6:118730686-118730708 AGACAAGGCACTAAAATGGTTGG - Intergenic
1019680818 7:2348139-2348161 AGTTCACACACTGAAAAGGGCGG + Intronic
1023133911 7:37031941-37031963 AGCCCAGGCACTGAAATGTGTGG - Intronic
1024445335 7:49471116-49471138 TCTCCACTCAGTAAAATGGGTGG + Intergenic
1043865486 8:85370032-85370054 AGGCCAGGAACTGAAATGGGGGG + Intronic
1049526575 8:143129865-143129887 TGCCCAAGCACTAAAGTGGGCGG + Intergenic
1059860225 9:118452163-118452185 ACTCCAGGGACTAAAGTGGGAGG + Intergenic
1196647143 X:118130304-118130326 AGTATACTCACAAAAATGGGTGG - Intergenic
1202160012 Y:21924038-21924060 AGGCCACGACCTAAAATGGAAGG - Intergenic