ID: 1148617817

View in Genome Browser
Species Human (GRCh38)
Location 17:49013836-49013858
Sequence CAAGGGCCGCGGGTCCCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 136}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148617792_1148617817 28 Left 1148617792 17:49013785-49013807 CCGCAGCCCCTGGCGCGGGTCCC 0: 1
1: 0
2: 2
3: 40
4: 797
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617791_1148617817 29 Left 1148617791 17:49013784-49013806 CCCGCAGCCCCTGGCGCGGGTCC 0: 1
1: 0
2: 3
3: 39
4: 340
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617793_1148617817 22 Left 1148617793 17:49013791-49013813 CCCCTGGCGCGGGTCCCCTCCCC 0: 1
1: 0
2: 2
3: 33
4: 283
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617800_1148617817 8 Left 1148617800 17:49013805-49013827 CCCCTCCCCCTCGGGGCCCAGGG 0: 1
1: 0
2: 1
3: 92
4: 534
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617806_1148617817 3 Left 1148617806 17:49013810-49013832 CCCCCTCGGGGCCCAGGGCGGGT 0: 1
1: 0
2: 0
3: 24
4: 222
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617803_1148617817 6 Left 1148617803 17:49013807-49013829 CCTCCCCCTCGGGGCCCAGGGCG 0: 1
1: 0
2: 0
3: 33
4: 353
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617809_1148617817 0 Left 1148617809 17:49013813-49013835 CCTCGGGGCCCAGGGCGGGTAGC 0: 1
1: 0
2: 2
3: 25
4: 184
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617802_1148617817 7 Left 1148617802 17:49013806-49013828 CCCTCCCCCTCGGGGCCCAGGGC 0: 1
1: 0
2: 0
3: 84
4: 498
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617794_1148617817 21 Left 1148617794 17:49013792-49013814 CCCTGGCGCGGGTCCCCTCCCCC 0: 1
1: 0
2: 3
3: 23
4: 282
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617790_1148617817 30 Left 1148617790 17:49013783-49013805 CCCCGCAGCCCCTGGCGCGGGTC 0: 1
1: 0
2: 1
3: 17
4: 210
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617808_1148617817 1 Left 1148617808 17:49013812-49013834 CCCTCGGGGCCCAGGGCGGGTAG 0: 1
1: 0
2: 1
3: 8
4: 156
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617813_1148617817 -9 Left 1148617813 17:49013822-49013844 CCAGGGCGGGTAGCCAAGGGCCG 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617795_1148617817 20 Left 1148617795 17:49013793-49013815 CCTGGCGCGGGTCCCCTCCCCCT 0: 1
1: 0
2: 3
3: 38
4: 276
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617812_1148617817 -8 Left 1148617812 17:49013821-49013843 CCCAGGGCGGGTAGCCAAGGGCC 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136
1148617807_1148617817 2 Left 1148617807 17:49013811-49013833 CCCCTCGGGGCCCAGGGCGGGTA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148617817 Original CRISPR CAAGGGCCGCGGGTCCCCGC CGG Intronic
900134077 1:1106871-1106893 CCAGGGCCGGGGGTGCCGGCAGG - Intronic
900191618 1:1354580-1354602 CGAGGCCCGCGGATCCCAGCGGG - Intronic
900243786 1:1628685-1628707 CAAGGGCCCTGGGTCCCCCCCGG - Exonic
901686450 1:10946157-10946179 CCAGGGCAGCGGCTGCCCGCAGG + Intergenic
902885963 1:19405043-19405065 CAAGGGCTGGTGGTCCCGGCAGG - Intronic
904011528 1:27392947-27392969 CCAGGGCCTCGGGTCCCTGCAGG - Intronic
909622506 1:77683550-77683572 CACGGGCCGCGGTTACCAGCAGG - Intergenic
910251321 1:85201343-85201365 CCCGGGGCGCGGGTCCCCGGAGG - Intergenic
910760819 1:90729617-90729639 GCAGGGCCGCGGGTCACCGCAGG + Intergenic
915171062 1:153977510-153977532 CTAGGGCCGCGAGCCCCCGCCGG - Exonic
915279717 1:154814115-154814137 AAGGGGCTGCGGGTCCCAGCAGG - Intronic
918097347 1:181346129-181346151 CGAGGGCCGAGGGTTCCCTCTGG + Intergenic
920190672 1:204191739-204191761 CAAGGGCTGAGGGACCTCGCAGG - Intronic
922097119 1:222452002-222452024 CAAGGGCCTGGGGTCCCTGTTGG + Intergenic
922200137 1:223394140-223394162 CAAGGGCTGGGAGTCCCGGCTGG - Exonic
922724136 1:227914732-227914754 CAAGGGCAGCGGGGCCTGGCTGG - Intergenic
923537288 1:234863012-234863034 CCAAAGCCGCCGGTCCCCGCAGG + Intergenic
1066180445 10:32957442-32957464 CAAGAGTCGCCGGTCCCTGCCGG - Intronic
1066370352 10:34814649-34814671 CGGGGGCCGCGGGACCCGGCTGG + Intronic
1073503889 10:103967220-103967242 CAAGGCCCGCGCGTCCCCTCGGG - Exonic
1075339349 10:121633075-121633097 CAAGAGCCGCCTGTCCCTGCAGG - Intergenic
1076890224 10:133279795-133279817 CAGGAGCCGGGGGCCCCCGCAGG + Exonic
1077068425 11:655616-655638 CAGGGGCCGTGGGGCCGCGCTGG - Intronic
1077375669 11:2204173-2204195 CAGGGGCCTCGGGTCACTGCAGG - Intergenic
1077386100 11:2270245-2270267 CCGGGGACGCGGGTCTCCGCCGG + Exonic
1083560635 11:63670957-63670979 CAAGGGCCGGTGGTCCCCGTGGG - Intronic
1083901773 11:65646799-65646821 CCCGGGGCGCGGGTCGCCGCCGG + Exonic
1084636911 11:70398796-70398818 CGAGGGCCGGGGGTCCGCGAGGG + Intronic
1087785348 11:102347498-102347520 CAAGGGTCGAGGGTCGCCGGGGG + Exonic
1089201207 11:116725730-116725752 CAAGGGCAAAGGGACCCCGCCGG + Intergenic
1091154378 11:133360393-133360415 CAAGGGCCGACGATGCCCGCAGG + Intronic
1102518149 12:113463691-113463713 CAAGGGGCGCCGGCCTCCGCAGG - Intronic
1104624352 12:130339195-130339217 CGAGGCCCGGGGGTCCTCGCGGG + Intronic
1106185337 13:27404891-27404913 CAAGGCCAGCAGGTCCCGGCAGG + Intergenic
1112374461 13:98825827-98825849 CCAGGGCAGGGGGTCCCCGGGGG + Intronic
1114610334 14:24036194-24036216 CAAAGGCTGCGGGTTCCTGCGGG + Intergenic
1114612516 14:24052088-24052110 CATGTGCCGCGGCTCCCCGGCGG + Exonic
1117392220 14:55272192-55272214 GAAGGGCCGGGGGGACCCGCAGG + Intronic
1118797169 14:69153504-69153526 GCCGGCCCGCGGGTCCCCGCGGG - Intergenic
1121104674 14:91272649-91272671 CACGGTCTGCGGATCCCCGCCGG + Exonic
1123119374 14:105909734-105909756 CAAGGGCCGGGGGCTCCGGCGGG - Intergenic
1123693616 15:22860250-22860272 CAAGGTGCGCGGGTCACCTCAGG - Intronic
1123810366 15:23919272-23919294 CAAGGGCCCCGGTTCCTTGCTGG + Intergenic
1131072015 15:89471871-89471893 CAAGAGCAGCGGGTCACTGCCGG + Intronic
1132320165 15:100919535-100919557 CAGAGGCCGAGGCTCCCCGCGGG - Intronic
1133815642 16:9195339-9195361 CAATGGCCCTGGGTCCCTGCCGG - Intergenic
1138680166 16:58678429-58678451 CAAGGGCCGCTGGCCCCCTCCGG + Exonic
1140452796 16:75084673-75084695 CAAGGGCAGCGGGTGACAGCTGG - Intronic
1140478699 16:75251339-75251361 CCAGGGCCGCGGACCCCGGCCGG + Intronic
1141279456 16:82617905-82617927 CAAGGGCCCAGGGGCCCTGCAGG - Intergenic
1141699512 16:85636031-85636053 CAGAGGCCGCTGGTCCCCACTGG + Intronic
1142592260 17:1011469-1011491 CCAGGGCCCCAGGTCCCCTCTGG - Intronic
1142695290 17:1629637-1629659 CAAGGGTGGAGGGTCCCCGGAGG - Intergenic
1142763912 17:2055629-2055651 AACGGGCCGCGGGGCCCCGCGGG + Intronic
1143328969 17:6120242-6120264 CCAGGGCTGCCGGTCCCCGGGGG - Intronic
1148617817 17:49013836-49013858 CAAGGGCCGCGGGTCCCCGCCGG + Intronic
1148759695 17:49993361-49993383 CCAGGGCCGCGGGGGCGCGCGGG - Intronic
1148759793 17:49993737-49993759 CTGGGGCCGCGGCTCCCCCCTGG - Intronic
1150129256 17:62658154-62658176 CAAGGGCCGAGAGACTCCGCTGG - Intronic
1150326598 17:64263050-64263072 CAAGGGCCGCCGGACCCGACCGG + Intronic
1152552390 17:81036067-81036089 CAAGGGCCGCAGAGCACCGCTGG + Intronic
1152725223 17:81941776-81941798 CAAGGCCCTGGGGTCCCTGCTGG + Exonic
1152834413 17:82519963-82519985 CGGGGGCGGCGGGTCCCCGCCGG + Exonic
1152936359 17:83139765-83139787 TGAGGGCCGCGGGTCCCGACTGG + Intergenic
1152936370 17:83139809-83139831 TGAGGGCCGCGGGTCCTCACTGG + Intergenic
1152936379 17:83139841-83139863 TGAGGGCCGCGGGTCCTGGCTGG + Intergenic
1152936388 17:83139873-83139895 TGAGGGCCGCGGGTCCTGGCTGG + Intergenic
1152936397 17:83139905-83139927 TGAGGGCCGCGGGTCCTGGCTGG + Intergenic
1152936406 17:83139937-83139959 TGAGGGCCGCGGGTCCTGGCTGG + Intergenic
1152936415 17:83139969-83139991 TGAGGGCCGCGGGTCCTGGCTGG + Intergenic
1152936424 17:83140001-83140023 TGAGGGCCGCGGGTCCTGGCTGG + Intergenic
1152936444 17:83140073-83140095 TGAGGGCCGCGGGTCCTGGCTGG + Intergenic
1152936462 17:83140149-83140171 TGAGGGCCGCGGGTCCTCACTGG + Intergenic
1152936490 17:83140257-83140279 TGAGGGCCGCGGGTCCTCACTGG + Intergenic
1152936508 17:83140321-83140343 TGAGGGCCGCGGGTCCTGGCTGG + Intergenic
1152936517 17:83140353-83140375 TGAGGGCCGCGGGTCCTGGCTGG + Intergenic
1152936536 17:83140429-83140451 TGAGGGCCGCGGGCCCTCGCTGG + Intergenic
1154355280 18:13619820-13619842 CAAGGGCCCCCTGCCCCCGCAGG - Intronic
1159511494 18:69401776-69401798 CCAGCGCCGCGCGTCCCTGCCGG + Intronic
1161167932 19:2798504-2798526 TAAGGGCCGCGGGGACGCGCTGG - Intronic
1163427018 19:17245523-17245545 CATGGCCCGCGCGCCCCCGCCGG - Exonic
1163441687 19:17325137-17325159 CAAGCGCCCAGGGTCCCTGCTGG - Exonic
1163474229 19:17515715-17515737 CAAGGGCCGTGGGACCCTGGAGG + Intronic
1164159700 19:22618182-22618204 CAAGAGCAGCCGGTCCCCTCAGG - Intergenic
1167358937 19:49019707-49019729 CGGGGCGCGCGGGTCCCCGCTGG + Intergenic
931762615 2:65431344-65431366 CACGCGCCGCGGGGCCCCTCGGG + Intronic
932337355 2:70938718-70938740 CAAGGGCCTTGGCTCCCGGCTGG + Intronic
934210885 2:89977500-89977522 CAAGGGCCCAGAGTCCCGGCCGG + Intergenic
937083807 2:119157989-119158011 CCAGGGCCGCGGGGGCCCCCTGG - Exonic
942393537 2:175522198-175522220 CAAGGGCCTCAGTTCCCCGCTGG + Intergenic
1172275502 20:33676914-33676936 CGAGGACCGCCTGTCCCCGCTGG - Exonic
1175150290 20:56928327-56928349 CAAGGGCCAAGGGTCCCCTGGGG + Intergenic
1175284227 20:57827086-57827108 CAAGGGCCGTGGGTCCACTCTGG + Intergenic
1175763051 20:61574048-61574070 CCAGGGCTGTGGGTCCTCGCTGG - Intronic
1176111966 20:63415050-63415072 CAAGGGGAAGGGGTCCCCGCAGG - Exonic
1176376343 21:6088626-6088648 CATGGGCCGCGTGTCTCCCCCGG + Intergenic
1176546688 21:8205400-8205422 CACGCGCGGCGGGTCCCCGCGGG - Intergenic
1176554583 21:8249590-8249612 CACGCGCGGCGGGTCCCCGCGGG - Intergenic
1176565639 21:8388447-8388469 CACGCGCGGCGGGTCCCCGCGGG - Intergenic
1176573504 21:8432615-8432637 CACGCGCGGCGGGTCCCCGCGGG - Intergenic
1179747132 21:43449618-43449640 CATGGGCCGCGTGTCTCCCCCGG - Intergenic
1180070622 21:45434292-45434314 CACGGGCCGCCTGTCCCCGAGGG - Intronic
1180755344 22:18157157-18157179 CCAGGGCCGCAGGTCCCCTTGGG + Intronic
1181026777 22:20131609-20131631 CGAGAGCCGCGGGCGCCCGCCGG + Intronic
1181547533 22:23610586-23610608 CAAAGACCACGAGTCCCCGCGGG - Intronic
1183201291 22:36387398-36387420 CAGGGGCCGCGGCTCCCGGAAGG + Intronic
1184265278 22:43343053-43343075 CAGGGGGCGCGGGGCCGCGCGGG + Intronic
1184476970 22:44727221-44727243 CACGGCCCGGAGGTCCCCGCTGG + Intronic
1185098819 22:48826627-48826649 CAAGGGCAGCGGCTCCTCCCAGG + Intronic
1185133176 22:49052132-49052154 CCAGGAGCGCGTGTCCCCGCCGG + Intergenic
1203251553 22_KI270733v1_random:121666-121688 CACGCGCGGCGGGTCCCCGCGGG - Intergenic
1203259603 22_KI270733v1_random:166748-166770 CACGCGCGGCGGGTCCCCGCGGG - Intergenic
952382659 3:32817166-32817188 GCGGGGCCGCAGGTCCCCGCGGG - Intergenic
968518153 4:1023449-1023471 CAAGGGCCGCTGGCCCACACTGG - Intronic
969846958 4:9926918-9926940 CAAGGACTGCTGGTCCCCGTCGG + Intronic
975683521 4:76898015-76898037 GGAGGGCCGTGGGTCCCCTCCGG + Exonic
976236321 4:82900918-82900940 CACGGCCCGCCGGGCCCCGCAGG - Intronic
979780941 4:124650834-124650856 CAAGCCCCGCAGGCCCCCGCCGG - Intergenic
980930277 4:139177434-139177456 CGAGGGCGGCGGGGCCCCGCGGG - Intergenic
987108718 5:14664935-14664957 CTCGGGCCGCGGCTGCCCGCTGG - Exonic
992962835 5:81972441-81972463 CCGGGGAAGCGGGTCCCCGCCGG + Intronic
998282133 5:140821976-140821998 CAAGGGCCGCGGGGACCTTCTGG + Exonic
1002160565 5:177311959-177311981 CAAGGGCTGGGCGTTCCCGCGGG - Exonic
1002539152 5:179894446-179894468 GAAGGGCCGCGTGCCCCGGCAGG - Exonic
1002663095 5:180804047-180804069 AAAGGGCCGCGCGCACCCGCAGG + Intronic
1002926617 6:1609178-1609200 CAAGGGGTGCGGGGCCCTGCTGG - Intergenic
1006909564 6:37555238-37555260 AAAGGGCCACCGCTCCCCGCGGG - Intergenic
1015502890 6:133952280-133952302 CAGGGGCCGGGGGACCCCGGGGG - Intronic
1018686358 6:166307579-166307601 CTAGGGCCGCGGGCCCGCGGAGG - Exonic
1018914618 6:168125422-168125444 CAGGGGCTGCGGCTCCCCGGGGG + Intergenic
1019457538 7:1138253-1138275 CCTGGGGCGCGGGTCCCTGCCGG - Intronic
1021653591 7:22854135-22854157 CGAGGGCCTCCGGGCCCCGCGGG + Intergenic
1022510710 7:30933380-30933402 CAGGGGCAGCAGGTCCCCTCGGG - Intergenic
1024579934 7:50793284-50793306 CGGCGGGCGCGGGTCCCCGCGGG + Intronic
1026482413 7:70790251-70790273 CAGGGGCCCCGGGTGCACGCTGG - Exonic
1029114673 7:98231055-98231077 GCAGGGCCGCCCGTCCCCGCAGG - Exonic
1031484324 7:122310226-122310248 CAAGGCCAGCGGGTCGGCGCGGG - Intronic
1035553538 8:546338-546360 CCAGGGCCCCAGGTCCCCCCAGG - Intergenic
1036811021 8:11867848-11867870 CGAGGGTCCCGGCTCCCCGCCGG + Intronic
1037482092 8:19314183-19314205 CACGCGCCGCGTGTCCCTGCCGG - Intronic
1038267475 8:26047762-26047784 CAGGGGCCTCGGTGCCCCGCTGG + Intergenic
1038319749 8:26515095-26515117 GAAGGCCCGCGGCTCCCCGGTGG + Intronic
1039195604 8:35027972-35027994 CAAGAGCCAAGGCTCCCCGCAGG - Intergenic
1039467961 8:37797235-37797257 CCAGCGCTGTGGGTCCCCGCGGG + Exonic
1044999746 8:97869189-97869211 CGAGGGCCGCGGCTCTCCTCGGG - Exonic
1045516326 8:102863713-102863735 TAAGGGCGGCGGGGCCCAGCCGG + Intronic
1049552645 8:143267575-143267597 CAAGGGCCGCACGGCCCGGCTGG - Intronic
1049762659 8:144338110-144338132 CAAGTGCAGCGCGCCCCCGCAGG - Intergenic
1056960477 9:91118124-91118146 CAAGGGCCGCAGGTGCAGGCGGG + Intergenic
1057758460 9:97854554-97854576 CAAGGGCCGGGCGACGCCGCGGG - Exonic
1057758485 9:97854632-97854654 CAAGAGCCGCCGGGCCCCGACGG - Exonic
1203467955 Un_GL000220v1:104817-104839 CACGCGCGGCGGGTCCCCGCGGG - Intergenic
1203475776 Un_GL000220v1:148789-148811 CACGCGCGGCGGGTCCCCGCGGG - Intergenic
1185751037 X:2609579-2609601 GAGGGGCCGGGTGTCCCCGCGGG - Intergenic
1189237207 X:39496254-39496276 CATGGGCCGGGGGTGCCCACGGG - Intergenic
1191839727 X:65502881-65502903 ACAGGGCAGCGGGTCCCAGCTGG - Exonic
1198263859 X:134991189-134991211 TAAGAGCCGCGGGTCCCCTGCGG - Exonic