ID: 1148618252

View in Genome Browser
Species Human (GRCh38)
Location 17:49015635-49015657
Sequence GTGGAAGCACAGAGAATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 448}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148618252_1148618265 15 Left 1148618252 17:49015635-49015657 CCCCCCATTCTCTGTGCTTCCAC 0: 1
1: 0
2: 1
3: 32
4: 448
Right 1148618265 17:49015673-49015695 CTTTGGGAGCCACTCAAGGTCGG 0: 1
1: 0
2: 0
3: 22
4: 148
1148618252_1148618259 -1 Left 1148618252 17:49015635-49015657 CCCCCCATTCTCTGTGCTTCCAC 0: 1
1: 0
2: 1
3: 32
4: 448
Right 1148618259 17:49015657-49015679 CATGACCACTTCTCCCCTTTGGG 0: 1
1: 0
2: 0
3: 14
4: 149
1148618252_1148618271 24 Left 1148618252 17:49015635-49015657 CCCCCCATTCTCTGTGCTTCCAC 0: 1
1: 0
2: 1
3: 32
4: 448
Right 1148618271 17:49015682-49015704 CCACTCAAGGTCGGGGGAGAGGG 0: 1
1: 0
2: 0
3: 13
4: 143
1148618252_1148618261 11 Left 1148618252 17:49015635-49015657 CCCCCCATTCTCTGTGCTTCCAC 0: 1
1: 0
2: 1
3: 32
4: 448
Right 1148618261 17:49015669-49015691 TCCCCTTTGGGAGCCACTCAAGG 0: 1
1: 0
2: 2
3: 10
4: 169
1148618252_1148618267 17 Left 1148618252 17:49015635-49015657 CCCCCCATTCTCTGTGCTTCCAC 0: 1
1: 0
2: 1
3: 32
4: 448
Right 1148618267 17:49015675-49015697 TTGGGAGCCACTCAAGGTCGGGG 0: 1
1: 0
2: 0
3: 9
4: 103
1148618252_1148618266 16 Left 1148618252 17:49015635-49015657 CCCCCCATTCTCTGTGCTTCCAC 0: 1
1: 0
2: 1
3: 32
4: 448
Right 1148618266 17:49015674-49015696 TTTGGGAGCCACTCAAGGTCGGG 0: 1
1: 0
2: 3
3: 19
4: 163
1148618252_1148618258 -2 Left 1148618252 17:49015635-49015657 CCCCCCATTCTCTGTGCTTCCAC 0: 1
1: 0
2: 1
3: 32
4: 448
Right 1148618258 17:49015656-49015678 ACATGACCACTTCTCCCCTTTGG 0: 1
1: 0
2: 0
3: 19
4: 155
1148618252_1148618269 23 Left 1148618252 17:49015635-49015657 CCCCCCATTCTCTGTGCTTCCAC 0: 1
1: 0
2: 1
3: 32
4: 448
Right 1148618269 17:49015681-49015703 GCCACTCAAGGTCGGGGGAGAGG 0: 1
1: 0
2: 1
3: 16
4: 159
1148618252_1148618268 18 Left 1148618252 17:49015635-49015657 CCCCCCATTCTCTGTGCTTCCAC 0: 1
1: 0
2: 1
3: 32
4: 448
Right 1148618268 17:49015676-49015698 TGGGAGCCACTCAAGGTCGGGGG 0: 1
1: 0
2: 0
3: 12
4: 146
1148618252_1148618272 27 Left 1148618252 17:49015635-49015657 CCCCCCATTCTCTGTGCTTCCAC 0: 1
1: 0
2: 1
3: 32
4: 448
Right 1148618272 17:49015685-49015707 CTCAAGGTCGGGGGAGAGGGTGG 0: 1
1: 0
2: 0
3: 25
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148618252 Original CRISPR GTGGAAGCACAGAGAATGGG GGG (reversed) Intronic
900234746 1:1582808-1582830 GAGGAACCACAAAGAATGTGTGG - Intergenic
900333192 1:2146945-2146967 GTGGATGGATGGAGAATGGGCGG - Intronic
900507307 1:3036158-3036180 GCAGAAGCACAGAGAATGTTTGG + Intergenic
900649982 1:3725930-3725952 ATGGATGGACAGATAATGGGGGG + Intronic
900840631 1:5046054-5046076 GTAGAGACACAGAGAAGGGGTGG - Intergenic
901400387 1:9011536-9011558 GTGGAGCCCCAGAGAATAGGAGG - Intronic
901680046 1:10907843-10907865 GTGGAGGGATAGAGAGTGGGGGG + Intergenic
902464595 1:16608172-16608194 GTGGAAACAGAGAGAAATGGGGG + Intronic
902573006 1:17359067-17359089 GAGGGAGCAGAGGGAATGGGAGG + Intronic
903156213 1:21445533-21445555 GTGGAAACAGAGAGAAATGGGGG - Intronic
903400630 1:23043785-23043807 GTGGTAACACAGAGAAAGGCAGG - Intronic
905852296 1:41283182-41283204 GTGGAAGGCTAGAGAGTGGGGGG + Intergenic
907039074 1:51241763-51241785 TTGGAAGGACAGTGAGTGGGAGG + Intronic
907241092 1:53081496-53081518 GCTGAAGCACAGAGAGTGAGGGG + Intronic
907644813 1:56231723-56231745 ATGGAAGAAGAGAGAAAGGGCGG + Intergenic
907705006 1:56825406-56825428 GTGGAAGCCAAGAGAAAGGAAGG - Intergenic
908513763 1:64871662-64871684 GTGGAAGCTGAGAGAATTTGAGG - Intronic
908936009 1:69376418-69376440 TTGGAAGAAAAGAGAATGGAAGG + Intergenic
909233751 1:73125423-73125445 GTTGAAGCACTAAGAATGGATGG - Intergenic
909551171 1:76899302-76899324 GTAGAGACACAGAGAAGGGGTGG + Intronic
909915409 1:81312143-81312165 ATGGAAGCAAAGAGAATGTAAGG + Intronic
910134647 1:83953071-83953093 TTTGAAGGACAGAAAATGGGTGG + Intronic
910294423 1:85629899-85629921 GTGAAAGCCCATAGAATGGCAGG + Intergenic
912007078 1:104917379-104917401 GTGGAACCAGAGAGAAAGGTCGG + Intergenic
912852757 1:113141186-113141208 GAGGAAGCAGAGGGAACGGGAGG - Intergenic
913558329 1:119992011-119992033 GTGGAAGCAGTGAGCCTGGGCGG - Intronic
913639512 1:120798440-120798462 GTGGAAGCAGTGAGCCTGGGCGG + Intergenic
913993351 1:143635173-143635195 GTGGAAACACAGAGGAATGGAGG + Intergenic
914278936 1:146151501-146151523 GTGGAAGCAGTGAGCCTGGGCGG - Intronic
914435575 1:147656420-147656442 GAGGAAGCACAGAAAAGGAGGGG - Intronic
914539983 1:148602443-148602465 GTGGAAGCAGTGAGCCTGGGCGG - Intronic
914626663 1:149468774-149468796 GTGGAAGCAGTGAGCCTGGGCGG + Intergenic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
915314998 1:155023499-155023521 CAGGAAGCACAGAGGGTGGGTGG - Intronic
915466496 1:156101571-156101593 GTGGAGGCAGAGAGACTGGTTGG + Intronic
915730668 1:158051874-158051896 GTGGAAGCTGAGAGGAAGGGAGG - Intronic
917159301 1:172039774-172039796 GAGGAAGAACAGAGAAAGGAAGG - Intronic
918016070 1:180633124-180633146 GTGTTAGCACAGAAATTGGGAGG - Intronic
918622675 1:186623247-186623269 TGGGAAGCACACAGAAGGGGAGG + Intergenic
918928211 1:190815317-190815339 CTGACAGCACACAGAATGGGAGG + Intergenic
920999049 1:211024441-211024463 GCTGAAGCACAGTGAGTGGGAGG + Intronic
921312706 1:213860538-213860560 GAAGAACCACAGAGAAGGGGTGG + Intergenic
921334034 1:214068221-214068243 TTGGGAGCACAGAGAAGGGAGGG + Intergenic
922048263 1:221967173-221967195 GTAGAGACACAGAGAAGGGGTGG - Intergenic
922338260 1:224635145-224635167 GTGGTAGGACAGAGAATGGCGGG + Intronic
922504899 1:226120786-226120808 GTGGATGCAGAGGGAATGGGAGG + Intergenic
1063823574 10:9866859-9866881 GTCCAAGCACATAGAATAGGTGG - Intergenic
1064764206 10:18654287-18654309 CTGGAAGAACAGAAAAAGGGAGG - Intronic
1064780844 10:18836390-18836412 GTGCATGCACAGAGACTGGGGGG - Intergenic
1067837930 10:49652959-49652981 GTGGTATGACAGAGAATGGGTGG - Intronic
1068548504 10:58379938-58379960 GTAGGAGCACAGAGAATGATGGG - Intergenic
1069495309 10:68898351-68898373 GTAAAGGCAAAGAGAATGGGAGG - Intergenic
1069642757 10:69966528-69966550 CTGGAGGCTCAGAGCATGGGCGG - Intergenic
1069772011 10:70906097-70906119 GTGGGAGCACAGAGAGAGGAGGG + Intergenic
1069891805 10:71656786-71656808 GTGGATGCACAGAGAGCAGGAGG + Intronic
1070191288 10:74114099-74114121 GGAGAAGCACAGAGAAGAGGAGG - Intronic
1070489748 10:76965446-76965468 GTGGCAGCAGAGAGAAGGGTTGG - Intronic
1070647538 10:78212130-78212152 GCGGAAGCACAGTGGAGGGGAGG + Intergenic
1072517729 10:96202381-96202403 GTGGAAGCAGTGAGAGTGGTTGG + Intronic
1073020440 10:100439060-100439082 GTGAGAGCACAGAGGAAGGGAGG - Intergenic
1073127825 10:101162916-101162938 GGGGAAGCACAGACATTGGAGGG + Intergenic
1073186175 10:101616267-101616289 ATGGCTGCAAAGAGAATGGGAGG + Intronic
1073654047 10:105393197-105393219 GAGGAAGCATAGAGAAAAGGAGG + Intergenic
1074120056 10:110487479-110487501 GCGGAAGCACAGGAAGTGGGAGG - Intergenic
1074573767 10:114649299-114649321 GCGGAGGCACAGAGAATCGCTGG + Intronic
1075011642 10:118875433-118875455 GTGGCAGAAGAGAGAATGGGAGG - Intergenic
1075569735 10:123531178-123531200 TTGGAAGCACACAGACTGGTTGG - Intergenic
1075871903 10:125777355-125777377 GAGAAATCACAGAGAATAGGAGG - Intergenic
1075914862 10:126158312-126158334 GGGGAGGCACAGAGCATGGAGGG + Intronic
1075914935 10:126158699-126158721 GAGGATGCACAGAGCATGGTGGG + Intronic
1075914948 10:126158745-126158767 GGGGATGCACAGAGCACGGGTGG + Intronic
1075914975 10:126158880-126158902 GAGGATGCACAGAGCATGGTGGG + Intronic
1075914980 10:126158903-126158925 GAGGATGCACAGAGCATGGAGGG + Intronic
1075990448 10:126833965-126833987 GTGGACACACAGAGAATGGGGGG - Intergenic
1076024383 10:127100233-127100255 GTGGCAGCAAAGCCAATGGGAGG + Intronic
1076296149 10:129386383-129386405 GAGGAAGGAAAGAGAAGGGGAGG + Intergenic
1076370941 10:129953239-129953261 GTGAAATCACAGACAATGGAAGG + Intronic
1076831554 10:132996830-132996852 GAGGACGCACAGAGACTGAGGGG + Intergenic
1078757445 11:14224294-14224316 TTGGAAGCACAGAGGAAGGGTGG + Intronic
1079298616 11:19257323-19257345 GTGGAAGCACAAAGAATCATTGG + Intergenic
1079571724 11:21952139-21952161 GGGGAAGCACAGAAAATATGTGG + Intergenic
1081486187 11:43531290-43531312 GTGGTGGCACAAAGAAAGGGTGG - Intergenic
1081521455 11:43885835-43885857 GTGGTAACACAGAGGATGAGAGG + Intronic
1081703320 11:45165378-45165400 TTGGAAGCAGCCAGAATGGGAGG + Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084020447 11:66414121-66414143 GAGGAAGCACAGGGGCTGGGGGG + Intergenic
1084607948 11:70183497-70183519 GTGAGGTCACAGAGAATGGGGGG + Intronic
1084717626 11:70883710-70883732 CCGGAGGCACAGAGAAGGGGTGG + Intronic
1084766399 11:71311791-71311813 CTGGAAGCACAGAGCAGGTGTGG - Intergenic
1085216254 11:74835449-74835471 GTGGAGGCACAGGGAAGGGGAGG - Intronic
1085734321 11:79026028-79026050 GTTGGAGCACAGAGAATCGAAGG - Intronic
1088907867 11:114168621-114168643 GTGGAAGGAGAGAGAAAGAGAGG - Intronic
1089682492 11:120126714-120126736 GTAGAAGCTCAGAGAAGGGCAGG - Intronic
1090083366 11:123629410-123629432 GAGGAAGCACAGAGCATTGCTGG + Exonic
1090153691 11:124413665-124413687 GTGGAAGCATTGAGTATTGGTGG - Intergenic
1090283226 11:125476126-125476148 GTGGTTGCCCAGAGATTGGGCGG + Intronic
1090668988 11:128933124-128933146 GAGGAAGCTCCGAGCATGGGTGG - Intergenic
1090853130 11:130587956-130587978 ATGGAAGCACAGAGCCTGGCTGG - Intergenic
1091613480 12:2031397-2031419 GTGGCAGCACGGTGAATGGGGGG + Intronic
1091925874 12:4348226-4348248 GAGATAGCAGAGAGAATGGGAGG + Intronic
1091993079 12:4972622-4972644 GTGGCAGCAAGGAGAATGAGAGG + Intergenic
1092091187 12:5804937-5804959 GTGGGAGGACAGAAAATGGTTGG + Intronic
1092255716 12:6925950-6925972 TGGGAAGGCCAGAGAATGGGAGG - Intronic
1092926333 12:13275703-13275725 GTGGAGGCACAGTGAAAGGCAGG + Intergenic
1092996893 12:13959286-13959308 GTGAACGCCCAGAGACTGGGAGG + Intronic
1093015629 12:14151618-14151640 CTGGAAGCACAGAAAAGGGCTGG + Intergenic
1093227132 12:16498595-16498617 GTGGAAGGGCAGAGCATGTGAGG + Intronic
1093824361 12:23665303-23665325 GAGGAAACACACAGAATGTGTGG - Intronic
1094148385 12:27254787-27254809 GGGGAGGCACAGAGAGGGGGCGG + Intronic
1094229195 12:28083444-28083466 GTGGCAGGAGAGAGAAAGGGGGG + Intergenic
1095588584 12:43876640-43876662 GTGGAAGCTCAGAAAAGGTGAGG - Intronic
1096490589 12:52010637-52010659 AGGGAAGCACAGAGAAGGGCCGG - Intronic
1097363720 12:58687225-58687247 TCTGAAGCACAGAGAATGAGAGG - Intronic
1097790156 12:63806962-63806984 GTGGAAGCCCAGATTATTGGAGG - Intronic
1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG + Intergenic
1098992428 12:77078457-77078479 GTGCATGCACAGAGAAAAGGAGG + Intergenic
1101901495 12:108794252-108794274 TTGGAAGCCCAGAGCCTGGGCGG - Intronic
1103754884 12:123196989-123197011 GTGGAAGGACAGAATGTGGGGGG + Intronic
1104328250 12:127820248-127820270 ATGGGAGCACAGAGACAGGGAGG + Intergenic
1104760183 12:131293511-131293533 ATGGAAGCACAGAGAGTCCGGGG - Intergenic
1104819590 12:131667135-131667157 ATGGAAGCACAGAGAGTCCGGGG + Intergenic
1107571079 13:41658774-41658796 GTGGAAGCAGAGAGCATTGGTGG + Intronic
1107695212 13:42993136-42993158 GTGGAGGCACAGAGAAACTGGGG + Intergenic
1107696238 13:43002880-43002902 GTGGAAGCAGGGAGACTGGTTGG + Intergenic
1108639179 13:52366248-52366270 TTGGAAGCTCAGAGGATGGTGGG + Intergenic
1108650763 13:52477323-52477345 TTGGAAGCTCAGAGGATGGTGGG - Intergenic
1108679539 13:52767650-52767672 GTGGAAGCAGAGAGCAGGGTGGG + Intergenic
1109292206 13:60490419-60490441 GTGGAAGCAGAGAGAACAGAGGG + Intronic
1109637179 13:65136689-65136711 ATAGAGGCACAGAGAATGAGTGG - Intergenic
1110092542 13:71471143-71471165 ATGGGAGCACAGAGATTGGAGGG + Intronic
1113147240 13:107220878-107220900 GAGGAAGGGCAGAGCATGGGAGG + Intronic
1113431395 13:110254759-110254781 GGGGACACACAGAGAATGGCAGG - Intronic
1113560843 13:111279427-111279449 GTGCCCCCACAGAGAATGGGTGG - Intronic
1114287508 14:21259170-21259192 GTGAAAGCACAGATAATGAGGGG - Intronic
1114338417 14:21716657-21716679 ATGGCGCCACAGAGAATGGGGGG + Intergenic
1114618417 14:24080923-24080945 GTGGTGACACAGTGAATGGGAGG - Exonic
1115114722 14:29866560-29866582 GTGAAAGCACAGACAAAAGGAGG + Intronic
1115240746 14:31249798-31249820 GTAGCAACACAGAGAAGGGGTGG + Intergenic
1115845615 14:37530108-37530130 TTGGTAGCAGTGAGAATGGGAGG + Intronic
1116242996 14:42370666-42370688 GCTGAAGTACAGGGAATGGGAGG - Intergenic
1117958070 14:61137956-61137978 GTAGAGACACAGAGAAAGGGTGG + Intergenic
1118314046 14:64714813-64714835 GTGGAAGCACACAGCATGGATGG - Intronic
1118457955 14:65961803-65961825 ATGGCAGCAGAGAGAATGGAAGG + Intronic
1118513077 14:66497709-66497731 GAGGAAGCAGACAGAATGGTAGG - Intergenic
1121222846 14:92299434-92299456 GTGAAAGCACAGGGAAGTGGGGG - Intergenic
1121330070 14:93044191-93044213 GTGGGACAACAGAGAATGGTGGG + Intronic
1122014251 14:98780342-98780364 GTGGAAGCCCAGATGATGTGGGG + Intergenic
1122218355 14:100219156-100219178 ATGGAAGCACAGAGCAGAGGAGG - Intergenic
1122252673 14:100451001-100451023 GAGAAATTACAGAGAATGGGAGG + Intronic
1124032067 15:26020776-26020798 CTGGCAGCACAGAGTCTGGGGGG + Intergenic
1124232754 15:27959718-27959740 GTAGTCGCACAGAGACTGGGAGG - Intronic
1125793771 15:42389453-42389475 GTGAAAGCCCAGTGACTGGGAGG - Intronic
1128157586 15:65401593-65401615 GTGGGAGTGCAGAGAGTGGGTGG + Intronic
1129362642 15:75033929-75033951 GGGGAAGCACACAGAAGGGTTGG + Intronic
1129880522 15:79003635-79003657 GAGGCAGCACAGAGTCTGGGCGG - Intronic
1131285380 15:91052580-91052602 CTGGAAGAACAGAGATGGGGTGG - Intergenic
1131387945 15:92023044-92023066 GAGGAAGCACAGAGAAATTGAGG + Intronic
1131982133 15:98004473-98004495 GTGGACTCACAGAGAAAGAGAGG - Intergenic
1133596077 16:7294123-7294145 GTCGAAACACAGAGAGTGGGTGG + Intronic
1134244372 16:12529107-12529129 CGGGAGGCACAGAGACTGGGAGG - Intronic
1134347500 16:13404561-13404583 GCCAGAGCACAGAGAATGGGAGG + Intergenic
1134859174 16:17545776-17545798 GTTGGGGCACAGGGAATGGGAGG - Intergenic
1135055285 16:19226940-19226962 GTGTAAGGACAGAGAATCAGAGG + Intronic
1136482527 16:30551422-30551444 GTGGTAGCAGAGAGAAAAGGAGG + Intronic
1136558885 16:31026560-31026582 GTGGAGGCACAGAGAAATTGAGG - Intergenic
1137001321 16:35233279-35233301 GGAGAAGCAGAGGGAATGGGAGG - Intergenic
1137017611 16:35393176-35393198 GGGGAAGCAGAGGAAATGGGAGG - Intergenic
1137541190 16:49362986-49363008 ATTGAAGCACAGAGATGGGGAGG - Intergenic
1138399077 16:56730746-56730768 GAGTAAGCACAGAGAAGGGTGGG - Intronic
1139356942 16:66372149-66372171 GTGGGAGCATACAGACTGGGAGG - Intronic
1140560800 16:75978685-75978707 GGGGAAGAACAGACACTGGGTGG - Intergenic
1140718739 16:77751095-77751117 GTTGAAGTCCAGAGAATGAGGGG - Intergenic
1141364078 16:83426193-83426215 GTGGAAACCCAGAGGCTGGGAGG - Intronic
1141519343 16:84567269-84567291 GTTGAGGCACAGAGAATTGAAGG - Intronic
1141912795 16:87071365-87071387 GAGGAAGGACTGTGAATGGGAGG - Intergenic
1143273010 17:5689428-5689450 GTGGGAACACAGAGAGGGGGTGG + Intergenic
1144391542 17:14798185-14798207 GTGGATGCATAGATATTGGGTGG + Intergenic
1146106370 17:30040926-30040948 AGGGAAGAACAGAGAATGAGAGG - Intronic
1146265399 17:31449469-31449491 GTGGCAACAGAGAGAAAGGGAGG - Intronic
1147248217 17:39136121-39136143 GTGGAAGGACAGAGTAGGAGAGG - Intronic
1148157532 17:45432352-45432374 GGGGAAACGCAGAGAAGGGGAGG + Intronic
1148618252 17:49015635-49015657 GTGGAAGCACAGAGAATGGGGGG - Intronic
1149330544 17:55576867-55576889 CTGGGAGCACAGAGAGTAGGAGG + Intergenic
1150389215 17:64781042-64781064 GCGGGAACACAGAGAAGGGGAGG + Intergenic
1150842630 17:68623048-68623070 CTGGAGGCAGAGAGTATGGGTGG - Intergenic
1151113315 17:71704680-71704702 GTGGAAGGACAGGGACTGAGAGG - Intergenic
1152690169 17:81714328-81714350 GTGGAGGCCAACAGAATGGGAGG + Intronic
1152718127 17:81909605-81909627 GTGGAGACAGAGAGAGTGGGTGG + Intronic
1153232947 18:2957724-2957746 GTGGAAGCAGAGAGCAGAGGTGG + Intronic
1153271336 18:3324955-3324977 ATGGAAGCAAAGACAATGGAGGG + Intergenic
1155691654 18:28632175-28632197 ATGGAAGCCCATAGAATGGTGGG + Intergenic
1155697167 18:28697589-28697611 GTAGAGACACAGAGAAGGGGTGG + Intergenic
1155925252 18:31649086-31649108 GAGGCAGCACAGAGTGTGGGAGG - Intronic
1157302349 18:46488156-46488178 GTGGGAGCATAGGGAGTGGGAGG + Intronic
1157308562 18:46534880-46534902 GTGGGAGCACAGAAAAGGAGTGG - Intronic
1157471082 18:47989479-47989501 GGGGAAGTACAGAGAGAGGGAGG + Intergenic
1157732948 18:50020514-50020536 GTTGAAGCTGGGAGAATGGGAGG - Intronic
1158588905 18:58763235-58763257 GGGGAAGGAGAGAGAAAGGGGGG + Intergenic
1160078867 18:75704046-75704068 CTGGAGGCACAGAGACTTGGAGG + Intergenic
1160291725 18:77600902-77600924 GTGGCAGCACAGAGAGGGGAAGG - Intergenic
1160459399 18:79026542-79026564 GTGGCAGCAGAGAGCATGTGGGG + Intergenic
1161454896 19:4365210-4365232 GTGGAAGGACAGATGCTGGGGGG + Intronic
1161576691 19:5058378-5058400 ATGGAGGCAGGGAGAATGGGGGG + Intronic
1161847227 19:6718843-6718865 GTGGAGTCTCAGAGAAGGGGAGG + Intronic
1162859234 19:13493031-13493053 GGGGAAGGAGAGAGAAGGGGAGG + Intronic
1162947755 19:14054095-14054117 CTGGAGGCAGAGAGAAAGGGAGG - Exonic
1164202656 19:23031331-23031353 GTAGAGACACAGAGAAGGGGTGG + Intergenic
1164654343 19:29910012-29910034 GAGGAAGGAAAGAGAAAGGGGGG - Intergenic
1164654368 19:29910092-29910114 GAGGAAGGAAAGAGAAAGGGGGG - Intergenic
1164739828 19:30567621-30567643 GAGGGAGCATAGAGAGTGGGTGG + Intronic
1164740453 19:30571915-30571937 GTAGAAGCAGAGACAAGGGGTGG + Intronic
1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG + Intronic
1166251790 19:41576372-41576394 GAGGGAGCACAGAGACTGGCTGG + Intronic
1166255271 19:41599831-41599853 GAGGGAGCACAGAGACTGGCTGG + Intronic
1166281431 19:41796774-41796796 GAGGGATCACAGAGAATGGCTGG + Intronic
1166423247 19:42654301-42654323 GAGGAAGCACAGTGACTGGCTGG + Intronic
1166499655 19:43331289-43331311 GAGGAAGCACAGAGACTGGCTGG - Intergenic
1166642080 19:44501600-44501622 GGGGAGGCACAGAGCATGTGGGG - Intergenic
1167108621 19:47446126-47446148 GCGGAAGCGCAGAGGCTGGGAGG + Intronic
925333324 2:3075319-3075341 GTGGGAGCAGAGAGATGGGGTGG + Intergenic
925601992 2:5617517-5617539 GGGGAAGCACAGATGATGGTGGG + Intergenic
926070025 2:9880033-9880055 GTGGAAGCACGGAGACCAGGTGG + Intronic
926207842 2:10846775-10846797 ATGGATGCACAGAAAATTGGAGG + Intergenic
926419932 2:12686195-12686217 GAGGCAGCACAGAGCATGGAGGG - Intergenic
926531380 2:14050521-14050543 GTTGGAGGAGAGAGAATGGGGGG - Intergenic
928049037 2:27969330-27969352 CTGGAAGCACAGTGAGGGGGTGG + Intronic
928058091 2:28078893-28078915 ATGGAAGGACAGAGGAAGGGAGG - Intronic
928733769 2:34261860-34261882 GTGGTAGTATAGAGAATGGATGG - Intergenic
928827803 2:35441602-35441624 GTAGAGACACAGAGAAGGGGTGG + Intergenic
929571405 2:43025391-43025413 GTGGAGCCACAGAGTATGGTGGG + Intergenic
929665421 2:43830279-43830301 GTGAAAGCACAGAGCATGGAGGG - Intronic
931236790 2:60418846-60418868 GTAGAGACACAGAGAAGGGGTGG - Intergenic
932671571 2:73741748-73741770 GTGGAAGCAGAGAGAAAGTAAGG - Intergenic
933705989 2:85290865-85290887 CTGGAAGGACAGAGAATGAATGG - Intronic
933771764 2:85749145-85749167 GTGCTAGCACTGTGAATGGGAGG + Intergenic
934545212 2:95208457-95208479 GTTTAAGGACAGAGAATAGGAGG + Intronic
934958160 2:98642151-98642173 GTGGAAGGAGAAAGAAAGGGAGG + Intronic
935624041 2:105154237-105154259 ATGGAAGGTCAGGGAATGGGAGG + Intergenic
936618730 2:114073602-114073624 GTGGAAGGAGAGAGGATGGTGGG + Intergenic
937523068 2:122734983-122735005 GTGGGAGAAGAGAGTATGGGGGG + Intergenic
938016922 2:127874882-127874904 GGGGAACCAAAGAGAATGAGGGG - Intronic
939560454 2:143725583-143725605 GTGGAACCACAGGGAAGGAGGGG - Intronic
940052865 2:149482565-149482587 ATGGGAGCTCAGAGAATGGAAGG - Intergenic
940440441 2:153709095-153709117 CTGAAAGCACAGAGAATGAAAGG + Intergenic
940675956 2:156724575-156724597 GTAGAGACACAGAGAAGGGGTGG + Intergenic
940863274 2:158791659-158791681 GTGGAAGCAGAAAGAGTGGCAGG + Intergenic
941456352 2:165715001-165715023 GTAGAGACACAGAGAAGGGGTGG + Intergenic
942757905 2:179363840-179363862 GTGGAAGAAAGGAGAATGGTTGG - Intergenic
943117606 2:183692441-183692463 GGGAGAGCACAGTGAATGGGGGG - Intergenic
944001652 2:194845994-194846016 GTGTAACAACAGATAATGGGAGG - Intergenic
944322116 2:198358455-198358477 GTGGTAACATAGAGAATGAGAGG + Intronic
944995629 2:205290348-205290370 GAGGCAGCAAAGAAAATGGGAGG + Intronic
945603860 2:211902177-211902199 GTGGAGGCACAGAGAACAAGGGG - Intronic
946607001 2:221416296-221416318 GTGAAACCACTGAGAATGTGGGG + Intergenic
947423061 2:229958021-229958043 GTGGAACCACAGACACTTGGGGG + Intronic
948456681 2:238107728-238107750 GAGGAGGCACACAGAGTGGGAGG - Intronic
948648892 2:239426580-239426602 GGGAAAGCACACAGAGTGGGTGG + Intergenic
948669964 2:239561895-239561917 GAGGAAGCACACAGGCTGGGCGG + Intergenic
1169205258 20:3736230-3736252 GGGAAAGCACAGAGAGGGGGAGG - Intronic
1170211467 20:13849702-13849724 AAGGAAGCAAAGGGAATGGGTGG - Intronic
1171053398 20:21882964-21882986 GTGGTAGCTCAGAGCAAGGGAGG + Intergenic
1171207343 20:23291154-23291176 GTGGCAGGTCAGAGAATGGCAGG - Intergenic
1172600783 20:36181342-36181364 CTGCAAGCCCAGAGAAGGGGTGG - Intronic
1172788280 20:37484916-37484938 GAGGAAGCAAACAGAATGTGAGG + Intergenic
1173096050 20:40029574-40029596 ATGGAAGAACAGAGAAAGGGAGG + Intergenic
1173359713 20:42331666-42331688 GTGTATGCACAGAGAATTGGAGG + Intronic
1173920640 20:46742358-46742380 GTGCTAGGACAGAGGATGGGAGG + Intergenic
1173943637 20:46932931-46932953 GTGGCAGGACAGAGAGGGGGTGG - Intronic
1174295121 20:49540237-49540259 ATGGGGGCACAGAGAAGGGGAGG + Intronic
1174461650 20:50687280-50687302 GTGGATGCAGAGAGATCGGGTGG - Intronic
1175354287 20:58350945-58350967 GTGGTAGTACAAAGAATGGTAGG + Intronic
1175392497 20:58636073-58636095 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175392534 20:58636193-58636215 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175417399 20:58810963-58810985 GGGTAAGCACGGAGCATGGGTGG - Intergenic
1176060847 20:63172258-63172280 GGGGAGACACAGAGACTGGGAGG + Intergenic
1176060893 20:63172498-63172520 GGGGGGGCACAGAGACTGGGGGG + Intergenic
1177236396 21:18395104-18395126 GTGGAAGCACAGGGCTTGCGTGG + Intronic
1178804462 21:35826832-35826854 TTGGCATCACAGAGCATGGGTGG - Intronic
1178882944 21:36463024-36463046 GGGGGAGCACAGAGAAAGGAAGG + Intronic
1179005092 21:37507072-37507094 GGGTAAGAACAGAGAAGGGGAGG - Intronic
1180182475 21:46124163-46124185 GTGGGTGGACAGAGGATGGGTGG + Intronic
1181027982 22:20136488-20136510 AGGGAAGCCCAGAGAGTGGGAGG + Intronic
1181618670 22:24072460-24072482 CTGGTGGCACAGAGAATGGAAGG - Exonic
1181769194 22:25113194-25113216 GGGGAAGCACAGTGAGTGAGTGG + Intronic
1182013508 22:27020300-27020322 GTGGGGGGAGAGAGAATGGGAGG + Intergenic
1182351539 22:29702737-29702759 ATGGAAGCCCAGAGAGTGGAAGG - Intergenic
1183384043 22:37504737-37504759 GTTGGAGCACAGGGAATGGGAGG + Exonic
1183936923 22:41267898-41267920 GTGGGAGCACAGAGACTGACAGG - Intronic
1184449990 22:44577077-44577099 GTGGAAGCACAGAGGTGGGAAGG - Intergenic
1184486674 22:44783868-44783890 GTGGAGGCAGAGAGAATGATGGG - Intronic
1184889952 22:47373589-47373611 GAGGAAGCAAAGAGAAGGCGTGG + Intergenic
1185075761 22:48681260-48681282 GGAGAAGCACAGAAAATGAGGGG + Intronic
950297521 3:11845003-11845025 GGGGAAGCACAGGGAAGGGTAGG + Intronic
953177036 3:40562185-40562207 GTAGAGACACAGAGAAAGGGTGG - Intronic
955934730 3:64091666-64091688 GTGGAAGCTAAGAGAATGTATGG - Intergenic
956258786 3:67314078-67314100 GTGGAAGAAAAGATAAAGGGAGG - Intergenic
957041285 3:75337336-75337358 GTGGAAGCATAGAGAGTTGTTGG - Intergenic
960378327 3:116930104-116930126 GTGGAAGCGCAAAGGATGGCAGG + Intronic
960441608 3:117695482-117695504 GTGGAAGCATAGAGACTGTTAGG - Intergenic
961993580 3:131217662-131217684 GTGGAGGGAAAGAGAGTGGGAGG - Intronic
962660476 3:137596662-137596684 GTAGAGACACAGAGAAGGGGTGG - Intergenic
963159314 3:142134110-142134132 GTGGAAGCACACTGAAAGTGGGG + Intronic
963228471 3:142887158-142887180 GTCTAAGAATAGAGAATGGGGGG - Intronic
964402493 3:156313830-156313852 GTTAAAGCACAGAAAATGGAGGG + Intronic
964614554 3:158648743-158648765 GGGGAAGAACAGATAATGGAGGG - Intronic
965262810 3:166505321-166505343 GTAGAGACACAGAGAAGGGGTGG + Intergenic
965300437 3:167000071-167000093 CTGAAAGCACAGAGATTTGGGGG - Intergenic
965596415 3:170415608-170415630 ATGGAAGCAAAGAGAACTGGGGG - Intergenic
965922391 3:173933228-173933250 CTAGAAGCTCAGAGAATGGCAGG + Intronic
966836272 3:184051597-184051619 GTGGAAGGAGTGAGAAAGGGAGG - Intergenic
967193496 3:187005845-187005867 GTGGGAGCACACAGAAGGGAAGG + Intronic
967829195 3:193904374-193904396 GAGGAAGGAAAGAGAAGGGGAGG + Intergenic
968274068 3:197426431-197426453 GTGGAGGGACTGGGAATGGGAGG - Intergenic
968836167 4:2965742-2965764 ATAGAAGAACTGAGAATGGGTGG + Intronic
968916862 4:3500421-3500443 GTGGAGGCACTGACAATTGGGGG + Intronic
968976520 4:3824954-3824976 GTGGAACCACAGTGACGGGGAGG - Intergenic
969525199 4:7700738-7700760 GAGGGAGCACAGAGCATTGGGGG + Intronic
969648620 4:8448973-8448995 GGGGCAGCACAGGGAAGGGGAGG - Intronic
969705440 4:8788997-8789019 GTGGAAGCCCACAGACCGGGAGG + Intergenic
970136889 4:12935143-12935165 GTGGAAGCACAGATCATGAATGG + Intergenic
970509925 4:16771752-16771774 CTGGAGGCACAGAGAAGGGGTGG - Intronic
970548580 4:17155697-17155719 GTGTAAGCAAAGAAAGTGGGAGG - Intergenic
972228557 4:37043428-37043450 GTAGAAGCACTGAGAAAGTGGGG + Intergenic
972601984 4:40581042-40581064 GTGGGAGCACAGAGGTTGGGAGG + Intronic
972606516 4:40618977-40618999 GAGGAAGGACTGAGGATGGGGGG - Intronic
972763641 4:42131638-42131660 GTGGATGCACACAGGATGGAAGG + Intronic
973142057 4:46781673-46781695 GTGGAAGGAGAGGGAATGGTGGG + Intronic
973567011 4:52198955-52198977 CAGGAAGCACAGGGAATGAGGGG - Intergenic
974428550 4:61768784-61768806 GTAGAGGCACGGAGAAGGGGTGG + Intronic
975403718 4:73965809-73965831 GAGAAGGCACAGAGTATGGGTGG - Intergenic
975853935 4:78602689-78602711 GTGGGACCACAGAAAATGGCTGG - Intronic
976032385 4:80771771-80771793 GTGGAAGGACAGAGAAGGCATGG + Intronic
976614826 4:87065805-87065827 GAGGTTGCACAGAGAAAGGGGGG - Intronic
977981262 4:103325225-103325247 GGGGACTCACAGAGAAGGGGAGG + Intergenic
978584266 4:110260910-110260932 GTTGAAGGATTGAGAATGGGTGG + Intergenic
979542656 4:121903600-121903622 TGGGCAGCACAGAGAATGGAAGG - Intronic
980128871 4:128800076-128800098 ATGGAAGCATAGAGAAGGGTGGG + Intergenic
981799658 4:148640645-148640667 GTAGAAGCATGGAGCATGGGTGG + Intergenic
982488451 4:155998340-155998362 TTGGAAACTCAGAGGATGGGAGG - Intergenic
983707526 4:170678679-170678701 GTAGAGACACAGAGAAGGGGTGG - Intergenic
984638387 4:182139210-182139232 GTGGAAGCACTGCCAACGGGAGG + Intergenic
985163133 4:187064260-187064282 GTGCAAGAACAGAGAACGGCCGG - Intergenic
985293721 4:188412356-188412378 GAGGAAGCACAGGGAGTGGAAGG + Intergenic
986741693 5:10710630-10710652 TGGGAAGCACAGAGCCTGGGAGG + Intronic
987066123 5:14291291-14291313 GTGGAAGGAAAGAGAAAAGGTGG + Intronic
987984399 5:25127432-25127454 GTGGAAGGGCAGAAAATGGATGG + Intergenic
988110376 5:26812428-26812450 GTGGAAGGACATAAAAGGGGTGG + Intergenic
988681708 5:33489963-33489985 TTGGGAACACAGAGAGTGGGGGG - Intergenic
989405345 5:41054979-41055001 TTGGAAACAAAGAGGATGGGAGG - Intronic
989694720 5:44187005-44187027 GAGGAAGCAAAGAAAATTGGAGG + Intergenic
990546987 5:56832562-56832584 GTGGTAGCACAGCTAGTGGGTGG + Intronic
991137765 5:63203130-63203152 GGGGAAGCAGAGAGATTAGGTGG - Intergenic
991548288 5:67807888-67807910 GTGGAAAAACAGAGAAGGGGAGG - Intergenic
991968551 5:72115537-72115559 GTGGATGCCCACAAAATGGGAGG - Intronic
991978708 5:72209783-72209805 GTGTAAGGACAGAAACTGGGAGG + Intergenic
991996830 5:72396047-72396069 TTGCAAGCCCAGAGAATGAGGGG - Intergenic
992185008 5:74235465-74235487 GAGAAAGCACAGAGAGTTGGGGG - Intergenic
993836555 5:92825199-92825221 GTAGAGACACAGAGAAGGGGTGG - Intergenic
994448431 5:99908299-99908321 GCAGCAGCAGAGAGAATGGGTGG + Intergenic
994687182 5:102969961-102969983 GAGGAAGCACAGATGATAGGTGG + Intronic
994988791 5:106972140-106972162 GAGGAACCACAGGGAATGGGCGG - Intergenic
995414709 5:111896144-111896166 GAGGAAGCACAGAGATTGGTAGG + Intronic
995656977 5:114437325-114437347 GTGGGAACAGAGAGAAGGGGAGG + Intronic
995969626 5:117952449-117952471 ATGGAAGCCCAGAGAAGGGATGG + Intergenic
997440958 5:133908257-133908279 GAGGAGGCACAGAGCAGGGGTGG + Intergenic
997615278 5:135241986-135242008 GTGGAAGCACAGGGAGAGGAAGG - Intronic
997979029 5:138457703-138457725 GGGGAAGCACAGCGAATGCGGGG - Intergenic
998068548 5:139178487-139178509 GTTGGAGCACAGAGAGTGAGAGG - Intronic
998668402 5:144325433-144325455 GTGGAAGCAGAGAGCATGAAAGG - Intronic
999133656 5:149302782-149302804 GTGGAAGCACAGAGATCCAGAGG - Intronic
999675539 5:153998017-153998039 GTGAAACCACAGATAAGGGGGGG - Intronic
999712353 5:154329759-154329781 GATGAAGCACAGAGGGTGGGAGG - Intronic
1000971582 5:167720784-167720806 GTGGAAGCCCAGAGGAAGGAAGG + Intronic
1000992171 5:167922555-167922577 GTGCAAGCACAGAGAGAGGAAGG - Intronic
1001664631 5:173422108-173422130 GAGGAAGCAGAGAGATTGAGAGG - Intergenic
1001789515 5:174443881-174443903 GTGGAGGCACGGAGTAAGGGAGG - Intergenic
1002171448 5:177377033-177377055 CTGGGAGCACAGAAACTGGGAGG - Intergenic
1002194441 5:177494604-177494626 CAGGAAGCACAGAGGATGAGGGG + Intronic
1002421237 5:179150173-179150195 GAGGAGGCAGAGGGAATGGGAGG - Intronic
1003285532 6:4730734-4730756 TTGGAATCACAGAGATAGGGAGG - Intronic
1003286981 6:4742969-4742991 CTGGAAGCAAAGAGATTGGATGG - Intronic
1003826464 6:9958110-9958132 GTGAAAGCATGCAGAATGGGAGG - Intronic
1007326131 6:41061416-41061438 GTTGAAGCACAGGGCAAGGGGGG + Exonic
1007417179 6:41698557-41698579 GTGCAAGCCCAGAGGCTGGGAGG + Intronic
1007593378 6:43036926-43036948 CTGCAAGGACAGAGAAGGGGTGG + Intergenic
1008049800 6:46888737-46888759 GCGGAAGCAGAGAGAATAGCAGG + Intronic
1008960567 6:57261682-57261704 GTGGGGGCACAGCCAATGGGTGG + Intergenic
1010894688 6:81349605-81349627 GTAGAGACACAGAGAAGGGGTGG + Intergenic
1012592470 6:100999194-100999216 GTGTGAGCACAGAGAGTGGAAGG + Intergenic
1013225990 6:108119632-108119654 GTGGAAGTCCGGGGAATGGGAGG + Intronic
1013978756 6:116105243-116105265 GTGAATGCAGAGGGAATGGGGGG - Intronic
1014474201 6:121852738-121852760 CTGAAAGCACATAAAATGGGAGG + Intergenic
1015702945 6:136056059-136056081 GAGGTGGCACAGAGAATGAGGGG + Intronic
1016055872 6:139577304-139577326 GTGGAAGCACAGAGCATTCTGGG + Intergenic
1018186772 6:161272229-161272251 GTGGAAGCAGGAAGAATGGGTGG - Intronic
1019095298 6:169574888-169574910 GAGGAAGCAGGGAGCATGGGTGG + Intronic
1019702923 7:2482769-2482791 GTGGAAGCTGAGAAAATGAGGGG - Intergenic
1019881499 7:3865229-3865251 GTGGAAGCAGGGAGTGTGGGAGG + Intronic
1020281720 7:6653371-6653393 GTGGAAGCCCAGCGGGTGGGAGG - Exonic
1020674953 7:11171968-11171990 GTGCACGCACAGAGAGAGGGAGG + Intergenic
1021089454 7:16465820-16465842 GTGAAAACACAGAGAAGGGGTGG + Exonic
1022139669 7:27482371-27482393 GTGGAAGGAGATGGAATGGGAGG - Intergenic
1022721022 7:32942345-32942367 CCGGAAGAAGAGAGAATGGGCGG - Intergenic
1022948584 7:35313949-35313971 GTAGCAGCCAAGAGAATGGGAGG - Intergenic
1023775735 7:43604882-43604904 ATGGAAGCACAGAGAGAGAGAGG - Intronic
1023918597 7:44609040-44609062 GTTGAAGGACTGGGAATGGGAGG - Intronic
1024262013 7:47580508-47580530 GTGGTAGCACAGGGGGTGGGGGG - Intronic
1024304518 7:47916408-47916430 GGGGGATCACAGTGAATGGGAGG + Intronic
1024310709 7:47966510-47966532 GTGGAAACACAGGGTGTGGGGGG - Intronic
1024743289 7:52378259-52378281 GAAGAACCACAGAGAATGGAGGG - Intergenic
1025205953 7:56993575-56993597 GGTGATGCACAGAGAATGAGTGG + Intergenic
1025665987 7:63583364-63583386 GGTGATGCACAGAGAATGAGTGG - Intergenic
1025851359 7:65247344-65247366 GTGGAAATACAGACAATGGAAGG + Intergenic
1026109589 7:67448599-67448621 GTGGAATCACAGGGAGGGGGTGG - Intergenic
1026377446 7:69766098-69766120 TAAGAAGAACAGAGAATGGGCGG - Intronic
1026807296 7:73436298-73436320 TTGGAAGCACAGAGACGGGCGGG - Intergenic
1028669551 7:93385980-93386002 GTGGAAACACAGAGGATGGAGGG + Intergenic
1031728085 7:125263413-125263435 GTAGAGACACAGAGAAGGGGTGG + Intergenic
1031811493 7:126375158-126375180 GTGGAAGGACAGAGTAAGGGAGG - Intergenic
1031866990 7:127048325-127048347 GATGAAGCAGAGAGAATAGGAGG + Intronic
1031938703 7:127764305-127764327 GTGGAAGTACACATAATGTGTGG - Intronic
1032661193 7:133985651-133985673 GGGCATACACAGAGAATGGGTGG - Intronic
1032676266 7:134132685-134132707 TGGGAACCACAGAGAATGGTGGG + Intronic
1033594375 7:142845752-142845774 GAGCCAGCAGAGAGAATGGGAGG - Intergenic
1034105996 7:148490275-148490297 GCAGAGGCACAGAGACTGGGAGG - Intergenic
1034816123 7:154173555-154173577 GTGGAAGCACACAGAGAAGGGGG - Intronic
1034989821 7:155541411-155541433 GTAGAAGCAGAGAGGATGGAAGG - Intergenic
1035492162 7:159289719-159289741 GAGGCAGCATACAGAATGGGAGG + Intergenic
1035572768 8:684551-684573 GTGGTACCACAGAGAAGAGGGGG + Intronic
1037758601 8:21727362-21727384 GTGTAAGAACAGAGGATTGGGGG + Intronic
1037796257 8:21997767-21997789 GTAGAAGCAGAGAGAATGTAAGG + Intronic
1037829367 8:22178875-22178897 GTAGAAGCACTGAGAAGAGGGGG - Intronic
1038472488 8:27837412-27837434 GGGGAAGCAAAGAGAAAGTGTGG + Intronic
1039787589 8:40847513-40847535 GAGGAAGAACAGGGAAGGGGAGG + Intronic
1039944699 8:42119343-42119365 ATGGAATCTGAGAGAATGGGGGG + Intergenic
1040683999 8:49848358-49848380 TTGGATGCAGAGAGAATGGTAGG + Intergenic
1041184541 8:55285525-55285547 GGGAAAGCACAGAGAATAGGTGG + Intronic
1042325807 8:67526618-67526640 ATGGTATCACAGAGGATGGGTGG + Intronic
1043006392 8:74824304-74824326 GTGGAAGCCCAGAGAAAAAGGGG + Intergenic
1044534099 8:93339805-93339827 GTGGCAGCAGAAAGAATGAGTGG + Intergenic
1045084928 8:98671963-98671985 GTGGCAGGAGAGAGAATGAGTGG - Intronic
1045461298 8:102427846-102427868 GCAGAAGTAGAGAGAATGGGGGG - Intergenic
1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG + Intergenic
1047302951 8:123630374-123630396 TTGGAAACCCAGAGAATGGTAGG + Intergenic
1047503295 8:125458913-125458935 GTGGGAACACAGAGGAGGGGAGG + Intergenic
1047666065 8:127092398-127092420 GGGGAAACACACAGACTGGGAGG - Intergenic
1047734269 8:127752061-127752083 GAGGAAGTACAGAGTATGTGGGG + Intergenic
1049464615 8:142745075-142745097 GTGGATGGGCAGAGGATGGGTGG + Intergenic
1050067655 9:1777610-1777632 CTGGAAGCAAAGAGAAGTGGTGG + Intergenic
1050721848 9:8600100-8600122 GGTGGAGCACAGTGAATGGGAGG + Intronic
1051215751 9:14795566-14795588 GAGGAAGCACAGAAAAGGGAGGG + Intronic
1052281935 9:26742851-26742873 GAGGAAGAATAAAGAATGGGAGG + Intergenic
1052350988 9:27457998-27458020 TTGGAAATACAGAGAAAGGGTGG + Intronic
1055084272 9:72298518-72298540 GTGAAATCACAGATAATGGGTGG + Intergenic
1055471660 9:76617836-76617858 GTGGAAGCCCAGCCAATGGCTGG - Intronic
1056138237 9:83649573-83649595 GTGGAAAGACAGAGACTCGGTGG - Intergenic
1056882821 9:90413775-90413797 GTAGAGACACAGAGAAGGGGTGG - Intergenic
1059374651 9:113872754-113872776 GGGGAAGCCAAGAGAAGGGGAGG - Intergenic
1060471390 9:123951449-123951471 GTGGGAGCAGAGGGAATGAGGGG + Intergenic
1061181889 9:129029333-129029355 GTGGAAGAAATGGGAATGGGAGG - Intergenic
1061761014 9:132851342-132851364 GTGGGAGGACAGAGAAAGGAAGG - Intronic
1061779868 9:132989232-132989254 GGGGAAGCACAGAGAAGGAGTGG - Intronic
1062002295 9:134222424-134222446 GTGGCAGCACAGAGGCTGGCAGG - Intergenic
1062214610 9:135382465-135382487 GTGGGAAGACAGAGAATGTGCGG + Intergenic
1186881283 X:13868988-13869010 ATGGATGCATAGAGCATGGGAGG + Intronic
1188829951 X:34883999-34884021 GAGGAAGCACAGGGAAAGTGTGG - Intergenic
1189268921 X:39736686-39736708 TTGGAGGCTCAGAGAGTGGGTGG - Intergenic
1189648235 X:43157911-43157933 GTGGAAGGAGAGAGAAAGGAAGG + Intergenic
1191055416 X:56234815-56234837 CTGGGGACACAGAGAATGGGTGG + Intronic
1193329779 X:80223222-80223244 GTGGAAGGAGAGAGCAAGGGGGG - Intergenic
1194094110 X:89615724-89615746 GTGGCAGGAGAGAGAATGAGTGG + Intergenic
1195084353 X:101400291-101400313 GTGGAAGCAGAGAGATCAGGTGG + Intronic
1195573850 X:106427045-106427067 GTGTAAGGAAAGAGCATGGGGGG - Intergenic
1195967816 X:110444927-110444949 GTGGAATCAGAGAGAACAGGAGG - Intronic
1196491541 X:116273271-116273293 GTTGGAGCTTAGAGAATGGGAGG - Intergenic
1197186252 X:123590485-123590507 AAGGAAGCACAGAGGATGGGTGG - Intergenic
1197369314 X:125606776-125606798 GTGAAATCACAGATAATGAGGGG + Intergenic
1197984647 X:132254708-132254730 TTGGTAGAACAGAGAAGGGGAGG + Intergenic
1199387721 X:147242181-147242203 ATGGTAGCACTGAGACTGGGTGG - Intergenic
1200446739 Y:3271906-3271928 GTGGCAGGAGAGAGAATGAGTGG + Intergenic
1201196171 Y:11496614-11496636 ATGGAATCAAAAAGAATGGGCGG + Intergenic
1201547751 Y:15184525-15184547 GTGGAAGCACACAGATGGGTAGG - Intergenic