ID: 1148619435

View in Genome Browser
Species Human (GRCh38)
Location 17:49023132-49023154
Sequence TCCTCACAAGGGTAGATGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148619435 Original CRISPR TCCTCACAAGGGTAGATGTG GGG Intronic
900338803 1:2178024-2178046 TCCTCAGCAGGGTTGGTGTGGGG + Intronic
900980428 1:6043205-6043227 TCCTCAGAAGGGAAGGGGTGAGG + Intronic
907564831 1:55425073-55425095 TTCCCATAAGGGTTGATGTGTGG + Intergenic
907649307 1:56279280-56279302 TTCTCACAATGGTAAATGGGTGG + Intergenic
908901399 1:68960513-68960535 TCCTCACAAGAATACATGTTTGG - Intergenic
908989650 1:70071011-70071033 TCCTCACAAGGGTAGAAGTCTGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
915060081 1:153174414-153174436 TCCTCACCAGGCTAGTTTTGTGG - Intergenic
915327219 1:155086642-155086664 TCCTCCCATGGCTAGAAGTGGGG + Exonic
917978850 1:180256941-180256963 TCCCTACAAGGGCAGGTGTGTGG + Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
921294288 1:213687603-213687625 GCCACACAATGGTAGATGGGTGG + Intergenic
923461476 1:234213198-234213220 TCCCCACAAGGGTAGCTCTGTGG - Intronic
1067482012 10:46607476-46607498 TCCTGGCAAGTGTAGCTGTGGGG + Intergenic
1067612737 10:47734250-47734272 TCCTGGCAAGTGTAGCTGTGGGG - Intergenic
1067740385 10:48890945-48890967 TCCACATTAGGGGAGATGTGAGG - Intronic
1068659959 10:59613524-59613546 TCCTCACATGGGAAGGGGTGAGG + Intergenic
1071628162 10:87194357-87194379 TCCTGGCAAGTGTAGCTGTGGGG - Intergenic
1072451758 10:95544388-95544410 TCCTCAGAAGGGGTGATATGGGG - Intronic
1074956109 10:118391684-118391706 TCCTCACAATGGGAGAGGCGGGG - Intergenic
1076705708 10:132300384-132300406 TCCTCACAGGTGGAGAAGTGGGG + Intronic
1078617732 11:12881041-12881063 TCCTCACAAGAGTAAGTCTGAGG + Exonic
1083381170 11:62269842-62269864 TGCTCCCAAGAGTAGGTGTGAGG + Intergenic
1084209912 11:67616118-67616140 TCCGCAAAAGGGTAAAAGTGCGG + Intergenic
1084343884 11:68529824-68529846 TCCACACAAGGGCCAATGTGGGG - Intronic
1085937228 11:81162233-81162255 TCCTCATAAGGGTGGTGGTGAGG + Intergenic
1087006542 11:93477436-93477458 TCCTCACAGGGGCTGCTGTGCGG - Intergenic
1088916905 11:114234501-114234523 TCCTCAGAAGGCTAGCTATGTGG - Intronic
1096020190 12:48317735-48317757 TTCTGACAAGGGTGGATGTCTGG + Intergenic
1096861792 12:54534181-54534203 TAGTCACTAGGGTCGATGTGTGG + Intronic
1097294897 12:57951597-57951619 TTGTCCCATGGGTAGATGTGTGG + Intronic
1098079876 12:66772676-66772698 TCCGCACAAGCCTAGATGTTGGG - Intronic
1099879321 12:88448248-88448270 TCCACACAAGGCGAAATGTGAGG + Intergenic
1102061460 12:109935169-109935191 TGCTCACAAAGGTAGAAGTCAGG - Intronic
1103313503 12:120032148-120032170 TTCTAACACAGGTAGATGTGAGG - Intronic
1106029254 13:25984982-25985004 TCCTCAAAAGGGTGTGTGTGAGG - Intronic
1107087013 13:36435961-36435983 TTCTCATAAGATTAGATGTGGGG - Intronic
1110817614 13:79879439-79879461 TTCTCTCAAAGGTAGATATGAGG + Intergenic
1112751564 13:102588829-102588851 TCCTCACAGGGGAAGGGGTGAGG - Intergenic
1112973462 13:105288180-105288202 TCTTCTCCAGGGTAGATGTTAGG - Intergenic
1114340633 14:21739312-21739334 CCCTCAGAAGGGGAGATGTTGGG + Intergenic
1121500915 14:94436718-94436740 TCCTCACAACAGGAGATGAGCGG + Intergenic
1122019757 14:98827973-98827995 TTCTCATGAGGCTAGATGTGAGG + Intergenic
1126165900 15:45653585-45653607 CCCTCCCAAGGTTAGAGGTGGGG + Intronic
1132073703 15:98801499-98801521 TCCTCACAAAGGGAGCTTTGAGG + Intronic
1132196946 15:99921279-99921301 TCCTCAAAAAGTTAGATGTCCGG + Intergenic
1132395312 15:101468815-101468837 TCATCACTAGTGCAGATGTGAGG - Intronic
1133270806 16:4610042-4610064 GCCTCCCAAGGGGAGATGCGTGG + Intronic
1133897027 16:9939506-9939528 TTCTCACAATCGTAGATGGGTGG - Intronic
1136224095 16:28846948-28846970 TCCTCTCAGGGCTAGATGTCAGG - Intronic
1137872808 16:51966986-51967008 TCCTCGCAAGGGTGGATGTGGGG - Intergenic
1138387642 16:56647314-56647336 TCCTCTTAAGGGTTGCTGTGAGG + Intronic
1140778380 16:78271799-78271821 ACCTAACAAGGGAATATGTGAGG + Intronic
1141781322 16:86163515-86163537 TCCTCAAGAAGGTAGATTTGTGG + Intergenic
1148438060 17:47697360-47697382 CCCTCACAAGGGCAAATGGGCGG - Intronic
1148619435 17:49023132-49023154 TCCTCACAAGGGTAGATGTGGGG + Intronic
1149004367 17:51789805-51789827 CCCTTACAAGGGTAAAGGTGAGG - Intronic
1151328293 17:73392053-73392075 CCCTCAGGAGGGTGGATGTGGGG - Intronic
1153193785 18:2571143-2571165 TTCTGACAAGGGAAGAGGTGAGG - Exonic
1159116893 18:64124765-64124787 ACCTCACAAAGGTAGATGTGAGG - Intergenic
1159210679 18:65317446-65317468 TCCTCACTAGGGAAGTAGTGAGG - Intergenic
1160282316 18:77502830-77502852 TCTTCACAAGGTGAGATGTGGGG + Intergenic
1160422746 18:78758817-78758839 TCCACAGAAGGCTAGACGTGTGG + Intergenic
1161847740 19:6721331-6721353 TCCTGACAAGGGTAAGTGAGGGG - Intronic
1162781447 19:13008977-13008999 TCCTCACCGAGGTAGATTTGCGG + Intronic
1163583211 19:18150492-18150514 CCCTCAAATGGGTAGGTGTGGGG - Exonic
1166326264 19:42052931-42052953 AGCTCACAAGGGTAGCCGTGAGG + Intronic
1166755429 19:45187747-45187769 TCCTCACTTGGGTACCTGTGGGG + Intronic
1167502782 19:49856993-49857015 ACCTCACAGGGGGAGATGTGGGG - Exonic
1168339041 19:55613496-55613518 TCCGCACAAGGATGGATGAGTGG + Intronic
925219160 2:2123803-2123825 TCCTCACAAGGGTCTCTGTAAGG + Intronic
926801214 2:16662680-16662702 TGCTCACAAGGGCTGATGTGTGG + Intronic
926829078 2:16940755-16940777 TCATCAGAAGAATAGATGTGTGG + Intergenic
927081495 2:19635120-19635142 TCCTCCCATGGGTTGTTGTGAGG - Intergenic
927491830 2:23526010-23526032 TCCTCAGAAGCGTGGATGTTGGG + Intronic
927662147 2:25002095-25002117 TTCACTCAAGGGTAGAGGTGTGG - Intergenic
928048088 2:27958720-27958742 TCCTCACAAGAGTATTTGTTAGG - Intronic
928160106 2:28915160-28915182 TCCTTAAAAAGGTAGTTGTGTGG + Intronic
928314726 2:30236398-30236420 GCACCACAAGGGAAGATGTGTGG - Intronic
928588082 2:32783225-32783247 TCCTCACAAGACTAAATGAGTGG - Intronic
930341159 2:50116658-50116680 TCCTCAGAAGAAGAGATGTGGGG - Intronic
930958743 2:57233426-57233448 TCTTCAGGAGGGTAAATGTGAGG - Intergenic
933097379 2:78203666-78203688 CCCTGACAAGGGTGGCTGTGCGG - Intergenic
934527713 2:95061956-95061978 ACCTCACAAGGGTCTGTGTGTGG - Intergenic
941049579 2:160717590-160717612 TCCTATCAAGGGTAGATATTTGG - Intergenic
944398863 2:199302496-199302518 TCCTCACTTGGGAAGATGTTGGG - Intronic
948388489 2:237596372-237596394 TCCTCTGAAGGGTTGCTGTGAGG - Intronic
1170697590 20:18673713-18673735 TCCTCAGAGAGGTAGTTGTGTGG + Intronic
1172727160 20:37053758-37053780 TACTGACAAGGTTAAATGTGAGG + Intronic
1173317300 20:41956641-41956663 TCCTTATAAGGAAAGATGTGGGG + Intergenic
1173869194 20:46331094-46331116 TTCTCTCAAGGGCAGATGTATGG - Intergenic
1174524015 20:51157000-51157022 TCCTCTCCAGGGGAGAAGTGGGG + Intergenic
1180741855 22:18059020-18059042 TCCTCACCAGGCTGGATCTGGGG - Intergenic
1181057992 22:20268796-20268818 TCCGCAGAAGGGAAGAGGTGGGG - Intronic
1181380070 22:22495065-22495087 TCCTCAGAAGAGTATGTGTGTGG - Intronic
1181923090 22:26335888-26335910 TCCTCACTAGGCTTAATGTGAGG + Intronic
1182435168 22:30325818-30325840 TCCTCCCAAGGGCAGATCTTGGG - Intronic
1185203207 22:49521206-49521228 TCCTCACAAGGCTGGGTCTGTGG - Intronic
956739611 3:72265390-72265412 TCCTCCCCAGGGTAGATGTCAGG - Intergenic
958424071 3:93961449-93961471 TCCTCACAAGTGTAGGATTGAGG - Intronic
961669384 3:128517912-128517934 CCCTCCTAAGGGTGGATGTGTGG - Intergenic
965716097 3:171604837-171604859 TATTCACAAGGGTAGTTATGAGG - Intronic
965917571 3:173869531-173869553 TCCTCTTAATGGTAGATTTGGGG - Intronic
971259352 4:25042379-25042401 TGCTAACATGGGTGGATGTGAGG + Intergenic
971717015 4:30191037-30191059 TCCTCAAAAGGTTAAATGTAGGG + Intergenic
972726119 4:41747389-41747411 TCCTCCCGAGTGTAGATGTCGGG + Exonic
976281573 4:83332157-83332179 TCCTCAAAAGTGAAGATGTGTGG - Intronic
977757415 4:100689433-100689455 TCCTCCCATGGGTACAAGTGGGG - Intronic
978854467 4:113378261-113378283 TCCTCTTTAGGGTAGATGTAGGG - Intronic
979480434 4:121210151-121210173 TGCTCAAAAGGGTAGGTATGAGG + Intronic
979660923 4:123253991-123254013 ACCTCACAAAGGAAGCTGTGTGG + Intronic
982115976 4:152098778-152098800 TCCTCACAAGCCTGGCTGTGTGG + Intergenic
982130438 4:152224333-152224355 TCCTGCCAGGGGTAGCTGTGCGG + Intergenic
983116463 4:163823250-163823272 TCCTTACTGGGGTAGCTGTGAGG - Intronic
985285313 4:188330999-188331021 GCCTCACAAGGGCAGATAAGAGG - Intergenic
995708183 5:115007096-115007118 TCATCACAAGGGTAGGGGTTAGG - Intergenic
998641294 5:144014345-144014367 TCCTTAAAAGGGTAGGTGTCAGG + Intergenic
1003005640 6:2378511-2378533 TCTTCACAACGGTAGAGGTATGG + Intergenic
1003379991 6:5615906-5615928 TTCTAACAAGTGTAGATTTGGGG - Intronic
1004033452 6:11896781-11896803 TTCTCACAATGTTAGCTGTGGGG + Intergenic
1004514557 6:16311349-16311371 TGCTCACAAGGGTAGAGGTCAGG - Intronic
1015817846 6:137229004-137229026 ACCTCAGTAGAGTAGATGTGAGG + Intergenic
1016132010 6:140485548-140485570 AGATCAAAAGGGTAGATGTGGGG + Intergenic
1017363327 6:153603209-153603231 TCTTCACTAGGGCAGGTGTGTGG + Intergenic
1019335496 7:480727-480749 TCCTCACCAGGGTGGTGGTGGGG - Intergenic
1022129470 7:27391258-27391280 TCCTGAGAAGGGTACATGAGAGG - Intergenic
1022370960 7:29770927-29770949 TCCTAGCAATGGCAGATGTGGGG - Intergenic
1023085646 7:36567834-36567856 TCCTAACAAGAGTAGACGTGAGG - Intronic
1026300862 7:69096867-69096889 TCCCAACAAAGGTAGATTTGGGG + Intergenic
1027950391 7:84807679-84807701 TGCTGGCAGGGGTAGATGTGGGG + Intergenic
1035938409 8:3868406-3868428 TCCACACAAGGGCAGCTGGGGGG + Intronic
1038275257 8:26115909-26115931 TCCTCACTAGGGGACACGTGGGG + Intergenic
1043593678 8:81859485-81859507 TCCTCACAAGACTAGTTTTGTGG + Intergenic
1043622030 8:82206211-82206233 TCCCAACAAGGGTGGATGTGAGG - Intergenic
1051580572 9:18669353-18669375 ACCCCACAAATGTAGATGTGAGG + Intronic
1053286478 9:36852566-36852588 TCCTCACCAGGGTTATTGTGAGG - Intronic
1055285352 9:74723059-74723081 TTCACACAAGGAGAGATGTGGGG - Exonic
1055964035 9:81847786-81847808 TCCTCACATGGGGAGAAGAGCGG + Intergenic
1058622297 9:106896382-106896404 TCTTCACCAGTCTAGATGTGAGG + Intronic
1188340054 X:28988442-28988464 TCCTGACAAAGCTATATGTGAGG - Intronic
1190594097 X:52035687-52035709 TACACACATGGGTTGATGTGTGG - Intergenic
1195029156 X:100909577-100909599 ACCTCATAAGGGTTGTTGTGAGG + Intergenic
1195767843 X:108315606-108315628 TCAGCAAAAGGATAGATGTGTGG - Intronic
1196525123 X:116722121-116722143 TCCTCAGGAGGGTAAAGGTGAGG + Intergenic