ID: 1148621088

View in Genome Browser
Species Human (GRCh38)
Location 17:49035486-49035508
Sequence CCTCGCATCCGCATCTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 113}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148621088_1148621096 4 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621096 17:49035513-49035535 CTGGGAGGTGGCAGCGGTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 351
1148621088_1148621093 -8 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621093 17:49035501-49035523 ATGCGAGGTGCGCTGGGAGGTGG 0: 1
1: 0
2: 0
3: 24
4: 177
1148621088_1148621100 21 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621100 17:49035530-49035552 TCTGGGGCAGTGGCCTGCGGTGG 0: 1
1: 0
2: 3
3: 39
4: 278
1148621088_1148621097 5 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621097 17:49035514-49035536 TGGGAGGTGGCAGCGGTCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 393
1148621088_1148621102 26 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621102 17:49035535-49035557 GGCAGTGGCCTGCGGTGGGTAGG 0: 1
1: 0
2: 2
3: 37
4: 294
1148621088_1148621095 3 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621095 17:49035512-49035534 GCTGGGAGGTGGCAGCGGTCTGG 0: 1
1: 0
2: 2
3: 55
4: 518
1148621088_1148621098 11 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621098 17:49035520-49035542 GTGGCAGCGGTCTGGGGCAGTGG 0: 1
1: 0
2: 2
3: 38
4: 418
1148621088_1148621103 30 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621103 17:49035539-49035561 GTGGCCTGCGGTGGGTAGGCTGG 0: 1
1: 0
2: 1
3: 29
4: 251
1148621088_1148621101 22 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621101 17:49035531-49035553 CTGGGGCAGTGGCCTGCGGTGGG 0: 1
1: 0
2: 2
3: 31
4: 296
1148621088_1148621094 -2 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621094 17:49035507-49035529 GGTGCGCTGGGAGGTGGCAGCGG 0: 1
1: 0
2: 3
3: 48
4: 604
1148621088_1148621099 18 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621099 17:49035527-49035549 CGGTCTGGGGCAGTGGCCTGCGG 0: 1
1: 0
2: 1
3: 27
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148621088 Original CRISPR CCTCGCATCCGCATCTGCCC AGG (reversed) Intronic
900476895 1:2880234-2880256 CCTCCACTCCTCATCTGCCCAGG - Intergenic
902808062 1:18873002-18873024 CCTCCCTTCCCCTTCTGCCCAGG - Intronic
903229792 1:21914816-21914838 CCTGGCATTCACACCTGCCCGGG - Intronic
903337358 1:22634144-22634166 CCTGGGTTCCACATCTGCCCAGG + Intergenic
903338478 1:22640040-22640062 CCTAGCAGCCTCATCTACCCAGG + Intergenic
905108369 1:35577229-35577251 CCTCGCCGCCGCAGCTGCCCTGG - Intronic
906242773 1:44252156-44252178 GCTCGCATCAGTACCTGCCCTGG - Intronic
906293879 1:44637165-44637187 CCACTCCTCAGCATCTGCCCAGG - Intronic
906640490 1:47438141-47438163 TCTCGCAGCAGCAGCTGCCCAGG - Exonic
915456384 1:156043653-156043675 CCTCACATCTGCCTCTCCCCAGG + Intronic
917028668 1:170666881-170666903 CGTCGCCTCCGAATCTGCTCGGG - Intronic
918068534 1:181118274-181118296 CCTCTCCTCCCCATGTGCCCTGG - Intergenic
919142298 1:193587957-193587979 CCTCCCATCCCCATCTCCTCTGG - Intergenic
919727916 1:200895682-200895704 CCTCACATCTGCCTCTGCCGAGG - Intronic
919808206 1:201393269-201393291 CCTCGCAGCAGCATCTGACTGGG - Intronic
1069993411 10:72328676-72328698 CCTCGCCTACTCCTCTGCCCAGG - Intergenic
1072415859 10:95246236-95246258 CCTCACACCCGCTTCTTCCCTGG - Intronic
1075687403 10:124373920-124373942 ACTCGCATCCTCATGTGTCCTGG - Intergenic
1076375256 10:129979427-129979449 CCTTGCATCCTAATGTGCCCGGG + Intergenic
1084702388 11:70795922-70795944 ACTCACACCCGCATCAGCCCAGG + Intronic
1085305862 11:75485853-75485875 CCTCCCATCCCCACCAGCCCTGG - Intronic
1090832105 11:130427273-130427295 CCTCTCATCCGAATCTCCCGCGG - Intronic
1097143551 12:56923936-56923958 CCTCGCATCCGCTACAACCCTGG - Exonic
1103561242 12:121794195-121794217 TCTCGCGTCAGCATCTTCCCTGG - Exonic
1103921765 12:124402982-124403004 GCTTACATCCGCATCTGGCCCGG + Intronic
1104930918 12:132339097-132339119 CCTCGCCGCAGCCTCTGCCCCGG - Intergenic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1107839031 13:44436783-44436805 ACTGGGATCCGCATCTGCCTGGG - Intronic
1112208859 13:97352947-97352969 CCTCTTATCCCCATCAGCCCAGG - Intronic
1112462438 13:99614557-99614579 CCTCGCAGCTACACCTGCCCGGG - Intronic
1113780952 13:112977050-112977072 GCTCCCACCCGCATCAGCCCAGG + Intronic
1113913171 13:113854186-113854208 CCCAGCATCCACATCTGACCGGG - Intronic
1123211670 14:106767049-106767071 ACCCGCATCTGCACCTGCCCTGG + Intergenic
1127498743 15:59536714-59536736 TCTCTAATCAGCATCTGCCCAGG - Intergenic
1130208584 15:81901524-81901546 CCTCGTACCAGCCTCTGCCCTGG + Intergenic
1130880118 15:88047731-88047753 CCACACATCCTGATCTGCCCTGG + Intronic
1133284948 16:4686409-4686431 GTCCGCATCCGCATCTTCCCAGG + Intronic
1136362521 16:29790226-29790248 CCTCGCGTCCGTGTCAGCCCAGG - Intergenic
1137249703 16:46732615-46732637 CCTGTCATCAGCATCTCCCCAGG + Exonic
1142223574 16:88866657-88866679 CCTCGCGTCCGCACCTGCCCAGG + Intronic
1143361809 17:6377193-6377215 CCTGGCAACCGCACCTTCCCAGG + Intergenic
1143564812 17:7715090-7715112 CCACCCATCCCCATCTCCCCTGG - Intergenic
1143988750 17:10938704-10938726 CAACTCATCTGCATCTGCCCGGG - Intergenic
1145810379 17:27760685-27760707 CCTTGCATCCTCATCGGGCCTGG - Exonic
1146558832 17:33850751-33850773 CCAGGCATCCAGATCTGCCCTGG + Intronic
1146660056 17:34659697-34659719 CCTCCCATCTCCATCTGTCCAGG + Intergenic
1148621088 17:49035486-49035508 CCTCGCATCCGCATCTGCCCAGG - Intronic
1152196371 17:78920778-78920800 CCTCCCCTCCTCAACTGCCCAGG - Intronic
1159923019 18:74243301-74243323 ACTCGCATCTGGATCTGCCCAGG - Intergenic
1160981024 19:1816644-1816666 CCTCCCAGCCGCCTCTCCCCAGG - Intronic
1161553874 19:4929482-4929504 CCTCCCCTCCGCAGCTGCTCTGG + Intronic
1165156715 19:33793142-33793164 CCTGGCCTCCGCCTCTACCCTGG - Intergenic
1166733469 19:45071292-45071314 CCTCGCCTCAGCCCCTGCCCTGG + Intergenic
925188469 2:1865111-1865133 CCAGGCTACCGCATCTGCCCCGG + Intronic
926146697 2:10400814-10400836 CTTGGCATTCTCATCTGCCCTGG + Intronic
928938881 2:36707575-36707597 CCTCGAATTGGGATCTGCCCGGG + Intronic
929544593 2:42847455-42847477 CCTCGCAGCCGCTTCTGTCTTGG + Intergenic
932575219 2:72959027-72959049 CCTCGCAGCCCCAACAGCCCCGG + Intronic
933174288 2:79158645-79158667 ACTCACATCTGCATCTGTCCAGG + Exonic
933968256 2:87448211-87448233 CCTCCCCTCTGCCTCTGCCCTGG - Intergenic
936325541 2:111502293-111502315 CCTCCCCTCTGCCTCTGCCCTGG + Intergenic
945676583 2:212862220-212862242 CCTCTAATCTGCATCTGCTCTGG + Intergenic
946190217 2:218003885-218003907 CCTCGCCCCCACCTCTGCCCAGG + Intergenic
947455963 2:230254394-230254416 CCCCGCAGCCTCATCTGCTCAGG + Intronic
1168814651 20:728311-728333 CCCCGCCTCCGCAGCTGGCCCGG - Intergenic
1174739351 20:52997216-52997238 CCTCCCAGCTTCATCTGCCCTGG + Intronic
1175874314 20:62222166-62222188 CCTGTCATCCACAGCTGCCCAGG + Intergenic
1175901931 20:62363409-62363431 CCTGGCAGCCGCTTCTGTCCCGG + Intronic
1178214021 21:30572792-30572814 CCTAGTATCGGCATCTGGCCTGG + Intergenic
1181734686 22:24872431-24872453 CAGCACATCCCCATCTGCCCTGG - Intronic
1182147252 22:28004165-28004187 CCTGGCAACAGCATCTGCCCAGG - Intronic
1184617092 22:45645675-45645697 CCGGGGATCCGCACCTGCCCAGG + Intergenic
1185109710 22:48894155-48894177 CCTGGCCTCCGCTTCTTCCCTGG + Intergenic
950211594 3:11127247-11127269 CCCTGCCTCCACATCTGCCCTGG - Intergenic
950651018 3:14406705-14406727 CTTGGCATCAGCCTCTGCCCAGG - Intronic
954304976 3:49720855-49720877 CCTGACCTCTGCATCTGCCCAGG + Exonic
954391643 3:50270785-50270807 CCTCTCTTCGGCATCAGCCCAGG - Intronic
961873533 3:130004267-130004289 CCTCGCTTCCCCTTCTCCCCCGG - Intergenic
967075281 3:185996277-185996299 CCTTGCATCGGTAACTGCCCAGG + Intergenic
967817660 3:193812963-193812985 CCTTTCATATGCATCTGCCCAGG + Intergenic
967956010 3:194877799-194877821 CCAGGCATCCCCCTCTGCCCTGG + Intergenic
968134084 3:196209135-196209157 CAGGGCATCCGCATCTGTCCTGG - Intronic
969444049 4:7234062-7234084 CCTGGCAGCCCCATCTCCCCAGG + Intronic
984993068 4:185400460-185400482 CCTTCCATCCGCACCAGCCCTGG + Exonic
996849674 5:127938050-127938072 CCTCTCCTCAGCATCTTCCCTGG + Intergenic
1002494053 5:179599808-179599830 CCTCCCCTCGGCACCTGCCCCGG + Intronic
1004994905 6:21180979-21181001 CCTGGCAGCAGCATCTGACCAGG + Intronic
1006932209 6:37695291-37695313 ACTGGCATCTTCATCTGCCCTGG + Intronic
1007098205 6:39227503-39227525 CCTCCCATCTGCCTCTACCCGGG + Intronic
1017951769 6:159141257-159141279 ACTCCCTTCCTCATCTGCCCTGG + Intergenic
1018170158 6:161138097-161138119 CCTGGCACCTGCAGCTGCCCCGG + Intronic
1019372299 7:668978-669000 CCATCCATCAGCATCTGCCCAGG + Intronic
1022104007 7:27185611-27185633 CCTCCCACCCGCAGCTCCCCGGG + Intergenic
1023059513 7:36314548-36314570 CCCCACATCAGGATCTGCCCTGG - Intergenic
1030138789 7:106284792-106284814 CCGCTCCTCCTCATCTGCCCGGG + Intronic
1034636986 7:152575463-152575485 CCACCCACCCACATCTGCCCTGG + Intergenic
1035160943 7:156949670-156949692 CCGCGCAGCCGCCTCTTCCCCGG + Intergenic
1036641292 8:10585663-10585685 CCTCCCATCCTCAGCTGCCAAGG + Intergenic
1036899592 8:12660608-12660630 CCTGGCTTCCCCTTCTGCCCCGG - Intergenic
1036900661 8:12666755-12666777 CCTGGCTTCCCCTTCTGCCCCGG - Intergenic
1038020960 8:23551485-23551507 CCTAGCAGCAGGATCTGCCCTGG - Intronic
1040561314 8:48525474-48525496 GCTCCCAACTGCATCTGCCCAGG - Intergenic
1042651348 8:71045575-71045597 CCTCCCATCCTCTTCTCCCCGGG - Intergenic
1044328921 8:90893421-90893443 CATCACATCCGCAGCTCCCCTGG - Intronic
1047501487 8:125445272-125445294 CCTCGCAGCCGCAGCTGTACGGG - Intergenic
1047717899 8:127612757-127612779 CCTCTCATACTCATCTGCCATGG + Intergenic
1053053942 9:34982634-34982656 CCTGGCAGCTGCAGCTGCCCCGG - Intergenic
1056590797 9:87964324-87964346 CATCCCTTCAGCATCTGCCCTGG - Intergenic
1058720261 9:107757910-107757932 CATCTCATCCGCAACTTCCCAGG + Intergenic
1062139554 9:134948307-134948329 CCTCACCTCTGCACCTGCCCTGG + Intergenic
1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG + Intergenic
1192504482 X:71672638-71672660 CCTAGCATCCACACTTGCCCTGG - Intergenic
1192509468 X:71713388-71713410 CCTAGCATCCACACTTGCCCTGG + Intergenic
1192511275 X:71721755-71721777 CCTAGCATCCACACTTGCCCTGG - Intergenic
1192515422 X:71759798-71759820 CCTAGCATCCACACTTGCCCTGG + Intergenic
1192517229 X:71768165-71768187 CCTAGCATCCACACTTGCCCTGG - Intergenic
1192523859 X:71824667-71824689 CCTAGCATCCACACTTGCCCTGG - Intergenic
1198739483 X:139825803-139825825 CCTCACTTCCTCATGTGCCCTGG - Intronic
1199721040 X:150542945-150542967 CCTCACTTCCCCATCTGCTCAGG - Intergenic