ID: 1148621088

View in Genome Browser
Species Human (GRCh38)
Location 17:49035486-49035508
Sequence CCTCGCATCCGCATCTGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 113}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148621088_1148621095 3 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621095 17:49035512-49035534 GCTGGGAGGTGGCAGCGGTCTGG 0: 1
1: 0
2: 2
3: 55
4: 518
1148621088_1148621096 4 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621096 17:49035513-49035535 CTGGGAGGTGGCAGCGGTCTGGG 0: 1
1: 0
2: 1
3: 23
4: 351
1148621088_1148621094 -2 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621094 17:49035507-49035529 GGTGCGCTGGGAGGTGGCAGCGG 0: 1
1: 0
2: 3
3: 48
4: 604
1148621088_1148621098 11 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621098 17:49035520-49035542 GTGGCAGCGGTCTGGGGCAGTGG 0: 1
1: 0
2: 2
3: 38
4: 418
1148621088_1148621099 18 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621099 17:49035527-49035549 CGGTCTGGGGCAGTGGCCTGCGG 0: 1
1: 0
2: 1
3: 27
4: 289
1148621088_1148621102 26 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621102 17:49035535-49035557 GGCAGTGGCCTGCGGTGGGTAGG 0: 1
1: 0
2: 2
3: 37
4: 294
1148621088_1148621100 21 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621100 17:49035530-49035552 TCTGGGGCAGTGGCCTGCGGTGG 0: 1
1: 0
2: 3
3: 39
4: 278
1148621088_1148621101 22 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621101 17:49035531-49035553 CTGGGGCAGTGGCCTGCGGTGGG 0: 1
1: 0
2: 2
3: 31
4: 296
1148621088_1148621103 30 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621103 17:49035539-49035561 GTGGCCTGCGGTGGGTAGGCTGG 0: 1
1: 0
2: 1
3: 29
4: 251
1148621088_1148621093 -8 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621093 17:49035501-49035523 ATGCGAGGTGCGCTGGGAGGTGG 0: 1
1: 0
2: 0
3: 24
4: 177
1148621088_1148621097 5 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621097 17:49035514-49035536 TGGGAGGTGGCAGCGGTCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148621088 Original CRISPR CCTCGCATCCGCATCTGCCC AGG (reversed) Intronic