ID: 1148621093

View in Genome Browser
Species Human (GRCh38)
Location 17:49035501-49035523
Sequence ATGCGAGGTGCGCTGGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148621085_1148621093 1 Left 1148621085 17:49035477-49035499 CCCTGGGAGCCTGGGCAGATGCG 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1148621093 17:49035501-49035523 ATGCGAGGTGCGCTGGGAGGTGG 0: 1
1: 0
2: 0
3: 24
4: 177
1148621088_1148621093 -8 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621093 17:49035501-49035523 ATGCGAGGTGCGCTGGGAGGTGG 0: 1
1: 0
2: 0
3: 24
4: 177
1148621086_1148621093 0 Left 1148621086 17:49035478-49035500 CCTGGGAGCCTGGGCAGATGCGG 0: 1
1: 0
2: 3
3: 20
4: 324
Right 1148621093 17:49035501-49035523 ATGCGAGGTGCGCTGGGAGGTGG 0: 1
1: 0
2: 0
3: 24
4: 177
1148621080_1148621093 20 Left 1148621080 17:49035458-49035480 CCTAATTCAGTTATCTTTGCCCT 0: 1
1: 0
2: 0
3: 23
4: 273
Right 1148621093 17:49035501-49035523 ATGCGAGGTGCGCTGGGAGGTGG 0: 1
1: 0
2: 0
3: 24
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148621093 Original CRISPR ATGCGAGGTGCGCTGGGAGG TGG Intronic