ID: 1148621095

View in Genome Browser
Species Human (GRCh38)
Location 17:49035512-49035534
Sequence GCTGGGAGGTGGCAGCGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 518}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148621088_1148621095 3 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621095 17:49035512-49035534 GCTGGGAGGTGGCAGCGGTCTGG 0: 1
1: 0
2: 2
3: 55
4: 518
1148621085_1148621095 12 Left 1148621085 17:49035477-49035499 CCCTGGGAGCCTGGGCAGATGCG 0: 1
1: 0
2: 1
3: 15
4: 205
Right 1148621095 17:49035512-49035534 GCTGGGAGGTGGCAGCGGTCTGG 0: 1
1: 0
2: 2
3: 55
4: 518
1148621086_1148621095 11 Left 1148621086 17:49035478-49035500 CCTGGGAGCCTGGGCAGATGCGG 0: 1
1: 0
2: 3
3: 20
4: 324
Right 1148621095 17:49035512-49035534 GCTGGGAGGTGGCAGCGGTCTGG 0: 1
1: 0
2: 2
3: 55
4: 518

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148621095 Original CRISPR GCTGGGAGGTGGCAGCGGTC TGG Intronic