ID: 1148621101

View in Genome Browser
Species Human (GRCh38)
Location 17:49035531-49035553
Sequence CTGGGGCAGTGGCCTGCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148621086_1148621101 30 Left 1148621086 17:49035478-49035500 CCTGGGAGCCTGGGCAGATGCGG 0: 1
1: 0
2: 3
3: 20
4: 324
Right 1148621101 17:49035531-49035553 CTGGGGCAGTGGCCTGCGGTGGG 0: 1
1: 0
2: 2
3: 31
4: 296
1148621088_1148621101 22 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621101 17:49035531-49035553 CTGGGGCAGTGGCCTGCGGTGGG 0: 1
1: 0
2: 2
3: 31
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148621101 Original CRISPR CTGGGGCAGTGGCCTGCGGT GGG Intronic