ID: 1148621102

View in Genome Browser
Species Human (GRCh38)
Location 17:49035535-49035557
Sequence GGCAGTGGCCTGCGGTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148621088_1148621102 26 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621102 17:49035535-49035557 GGCAGTGGCCTGCGGTGGGTAGG 0: 1
1: 0
2: 2
3: 37
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148621102 Original CRISPR GGCAGTGGCCTGCGGTGGGT AGG Intronic