ID: 1148621103

View in Genome Browser
Species Human (GRCh38)
Location 17:49035539-49035561
Sequence GTGGCCTGCGGTGGGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 251}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148621088_1148621103 30 Left 1148621088 17:49035486-49035508 CCTGGGCAGATGCGGATGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 113
Right 1148621103 17:49035539-49035561 GTGGCCTGCGGTGGGTAGGCTGG 0: 1
1: 0
2: 1
3: 29
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148621103 Original CRISPR GTGGCCTGCGGTGGGTAGGC TGG Intronic