ID: 1148621603

View in Genome Browser
Species Human (GRCh38)
Location 17:49038656-49038678
Sequence CTCTTGCTAATACGAGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148621603 Original CRISPR CTCTTGCTAATACGAGTGTG TGG (reversed) Intronic
900185951 1:1333324-1333346 CTCCTGCTGCTACGACTGTGTGG + Exonic
904980088 1:34492688-34492710 CTCTTTCTAATAGGATCGTGAGG + Intergenic
915738504 1:158099863-158099885 CTGTTGCTAACAAGATTGTGTGG - Intronic
919111549 1:193225764-193225786 TTCTTGCTAATTTGAGTTTGAGG + Intronic
921119162 1:212121710-212121732 ATGTTGCTTATAAGAGTGTGAGG + Intergenic
1073798124 10:107011036-107011058 CTCCTGCTCATCCCAGTGTGTGG - Intronic
1074611759 10:115028416-115028438 CTCTTTCTACTACGTGTGAGAGG - Intergenic
1076305511 10:129463261-129463283 GTCTTTCTAATAGGAGTCTGTGG + Intergenic
1084214952 11:67642118-67642140 CTCTTGGAAACACGTGTGTGTGG + Intergenic
1086114126 11:83229433-83229455 TTATTGCTAATGCGCGTGTGTGG + Intronic
1089977781 11:122747276-122747298 CTCTTGCTAAGACGATTTTAGGG - Intronic
1100660682 12:96695183-96695205 CTCTTGCAAATTGGAGTGAGTGG + Intronic
1102998780 12:117369408-117369430 CTCCTGTTATTACTAGTGTGAGG + Intronic
1103535247 12:121629532-121629554 CTCTTGCTAAAAACAGTGTGGGG + Intronic
1114200578 14:20516029-20516051 CTCTTGCTAGTAGCAATGTGTGG + Intergenic
1122499055 14:102183227-102183249 ATCTTCCAAATACTAGTGTGAGG - Intronic
1124152708 15:27196241-27196263 CTCTTCCTTATACCAGTGTTAGG + Intronic
1134319303 16:13148283-13148305 CTCTTGCCTATGTGAGTGTGTGG - Intronic
1140817689 16:78636113-78636135 CTCTTGCTATTAAGAGTTTCTGG + Intronic
1148621603 17:49038656-49038678 CTCTTGCTAATACGAGTGTGTGG - Intronic
1151335625 17:73438024-73438046 CGCCGGCTACTACGAGTGTGAGG - Exonic
1151452823 17:74209434-74209456 CTCTTGCTGTTGGGAGTGTGAGG + Intronic
1155395002 18:25377673-25377695 CTCTTGCTTGTAGCAGTGTGTGG + Intergenic
928081025 2:28312411-28312433 CTCTTCAAAATACGTGTGTGTGG - Intronic
928363153 2:30681573-30681595 CTCCTGCTAATAGGAGAGTTGGG - Intergenic
928611229 2:32994199-32994221 CTCTTGCTAACTCGAGTGGGTGG - Intronic
929675043 2:43917960-43917982 TTCTTTCTAATAGCAGTGTGGGG - Intronic
937061635 2:118984309-118984331 CTTTTGCTAAAATGGGTGTGGGG - Intronic
1169630464 20:7625449-7625471 CTCTTGCTCTTAGGAGTTTGAGG + Intergenic
1170122596 20:12926789-12926811 CTCTTGGTCATAAGAGAGTGTGG + Intergenic
1172307793 20:33893895-33893917 CTGTTGCTAAGACTTGTGTGGGG - Intergenic
1183442752 22:37832540-37832562 CTCTTTCTGATACGAGTGTCTGG + Intronic
951471691 3:23063402-23063424 CTCTTGCTAGTCAGAGTTTGTGG + Intergenic
967297216 3:187976602-187976624 CATTTGCTAACACGATTGTGTGG - Intergenic
987235207 5:15935577-15935599 CTCTGGCAAATAGGGGTGTGGGG + Intronic
995533842 5:113116193-113116215 CTCATGCTAACAGGAGTGAGAGG + Intronic
1017030319 6:150215141-150215163 CTCTTTCTCATACAACTGTGGGG - Intronic
1017951849 6:159141802-159141824 CTGTTGCTAATAATATTGTGTGG - Intergenic
1035929813 8:3767568-3767590 CTTATCCAAATACGAGTGTGTGG + Intronic
1043863309 8:85347402-85347424 CTCTTGGTAATTAGATTGTGAGG - Intronic
1048649424 8:136458342-136458364 CCTTTGCTGATATGAGTGTGTGG - Intergenic
1055291282 9:74784745-74784767 CATTTGCTAATACTAGTTTGTGG + Intronic
1057200550 9:93137560-93137582 CTCTTGCTAACATGAGCGGGAGG + Intergenic
1061245610 9:129399964-129399986 CTCTAGCTCATCCCAGTGTGGGG + Intergenic
1200882885 Y:8238204-8238226 ATCATGGTAACACGAGTGTGAGG - Intergenic
1202110890 Y:21418506-21418528 ATCTTGGTAACACGAGAGTGAGG - Intergenic