ID: 1148623377

View in Genome Browser
Species Human (GRCh38)
Location 17:49051354-49051376
Sequence GGGGCTGCCCCCTTAGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148623364_1148623377 24 Left 1148623364 17:49051307-49051329 CCTTTAGGAACTCTCTATGGAGA 0: 1
1: 0
2: 1
3: 12
4: 171
Right 1148623377 17:49051354-49051376 GGGGCTGCCCCCTTAGGAGGAGG 0: 1
1: 0
2: 2
3: 27
4: 220
1148623363_1148623377 25 Left 1148623363 17:49051306-49051328 CCCTTTAGGAACTCTCTATGGAG 0: 1
1: 0
2: 1
3: 23
4: 232
Right 1148623377 17:49051354-49051376 GGGGCTGCCCCCTTAGGAGGAGG 0: 1
1: 0
2: 2
3: 27
4: 220
1148623373_1148623377 -4 Left 1148623373 17:49051335-49051357 CCTGGTGGGAAAGGCTTTGGGGG 0: 1
1: 0
2: 2
3: 20
4: 232
Right 1148623377 17:49051354-49051376 GGGGCTGCCCCCTTAGGAGGAGG 0: 1
1: 0
2: 2
3: 27
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148623377 Original CRISPR GGGGCTGCCCCCTTAGGAGG AGG Exonic
900143022 1:1146367-1146389 AGGGCTGCCCCAGCAGGAGGAGG - Intergenic
900359317 1:2280403-2280425 GGGGCAGCCCCCTTGTGAGAAGG - Intronic
900530015 1:3148500-3148522 GGAGCTGCCCCCTCAGAAGCAGG - Intronic
900800305 1:4733112-4733134 GGGGCTGCCCACTTTGTTGGAGG - Intronic
900954393 1:5877696-5877718 GGGGTTGTCCCCTTGGCAGGAGG + Intronic
903134846 1:21302740-21302762 CGCCCTGCCCCCTTTGGAGGTGG + Intronic
903928966 1:26851262-26851284 AGGGCAGCGCCCTCAGGAGGAGG + Intronic
905542842 1:38773859-38773881 GGGGCAGCACCCTAAGGTGGGGG + Intergenic
908360836 1:63367477-63367499 GAGGCGGCCGGCTTAGGAGGCGG - Intergenic
912704988 1:111904944-111904966 AGGGCTGCCCCCTCTGCAGGTGG - Intronic
913301270 1:117371900-117371922 GCAGCTGCTCCCTTGGGAGGGGG + Intronic
915599540 1:156913680-156913702 GCGGCTGCTCCCTGAGGAGGAGG - Exonic
917538865 1:175894440-175894462 GTGGCTGCCCCTTAAGGAGGAGG + Intergenic
920068016 1:203282805-203282827 TGGGCTGCCCCTATGGGAGGTGG + Intergenic
920821535 1:209386273-209386295 GAGGCTGCCCACTAGGGAGGTGG - Intergenic
923188171 1:231594581-231594603 GGGGTTGACACCTTAGGAAGTGG + Intronic
923783071 1:237042679-237042701 GGGGGTGCCCCCTGAGGATGCGG + Intronic
1065505674 10:26428027-26428049 GGGGCTATGCCCTTGGGAGGGGG - Intergenic
1066387529 10:34953839-34953861 GGGTCTGCTCCCATGGGAGGTGG - Intergenic
1067089313 10:43258549-43258571 GCGGCTGGCCCCTTGGGACGAGG + Intronic
1067260646 10:44687403-44687425 GGGGCTGAGCCCTTTGGATGAGG - Intergenic
1067992562 10:51231429-51231451 ATGGCTGTCCCCTGAGGAGGAGG + Intronic
1069504909 10:68989054-68989076 GGGGCTGCCGGCTGAGGTGGTGG + Exonic
1069660659 10:70121352-70121374 GAGGCAGCCCCCATGGGAGGGGG + Intronic
1070776925 10:79115181-79115203 GGGTCTGCTACCTTGGGAGGTGG - Intronic
1071831647 10:89378226-89378248 GGGACAGCTCCCTTAGGAGAAGG - Intronic
1073097397 10:100988219-100988241 GGGGGTACCCACTTCGGAGGAGG - Exonic
1073458301 10:103650990-103651012 GGGGCTGCTTCCATAGGATGTGG - Intronic
1075394973 10:122120486-122120508 GGTGCTGCCTCCCTAGGAAGAGG - Intronic
1076371870 10:129960330-129960352 GGGGCTGCCCTCCTGGGAAGAGG + Intronic
1077161226 11:1113545-1113567 GGAGCTGCCCCTTCAGGTGGAGG + Intergenic
1077312557 11:1896938-1896960 GGGGCTGCCCCATTAGCGAGTGG - Intergenic
1077541857 11:3150426-3150448 TGGGCTCCTCCCTAAGGAGGAGG - Intronic
1077888640 11:6403662-6403684 GGGGCTGCTCCCCTGTGAGGGGG + Exonic
1077955436 11:7014607-7014629 GTGGCTGCCCCTTTAGGAGAGGG + Intronic
1079129060 11:17737112-17737134 GAGGCTGCTCCCTGAGGAGGGGG - Intronic
1080037290 11:27722627-27722649 GGGGCAGCCCCCGCAGGATGAGG - Intergenic
1080349713 11:31369591-31369613 GGGGGTGCTCGCTGAGGAGGAGG + Intronic
1081340117 11:41917714-41917736 GGGCCTGAGCCCTTAGGGGGAGG - Intergenic
1081661139 11:44889204-44889226 GGGGGCACCCCCTTAGGAAGTGG + Intronic
1083026949 11:59559156-59559178 GAGGCTGCCCTCTTAGCTGGTGG - Intergenic
1083590034 11:63888468-63888490 GGGGCTGCCCACTTCCGGGGAGG + Intronic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1084083418 11:66843592-66843614 GAGGCTGCCCACGTAGGAGCAGG - Exonic
1084731358 11:71075680-71075702 TGTGCTGCCCCCTTGGAAGGGGG - Intronic
1084947057 11:72643803-72643825 AGGGCTGCCCCCTGAGTTGGTGG - Intronic
1085026797 11:73241001-73241023 AGGGCTGCACCCTTAGGACCTGG - Intergenic
1086547582 11:88015970-88015992 AGGGCTACCCCATTGGGAGGTGG - Intergenic
1087144640 11:94799748-94799770 GGAACTGCCCACTTACGAGGAGG + Exonic
1089567360 11:119378794-119378816 GGGGCTCTCCCCTTGGGAGGGGG - Intronic
1090397928 11:126431595-126431617 GGGGCTGCCCCCGCAGGAACGGG - Intronic
1090715840 11:129430046-129430068 AGGGCTGCCCTCTGTGGAGGTGG - Intronic
1092023806 12:5224012-5224034 GCGGCGGCCACCCTAGGAGGAGG - Intergenic
1102475742 12:113186991-113187013 GGTGCTGCCCCTTGAGGGGGTGG - Exonic
1103723176 12:122985509-122985531 GGGGCTGTAGCCATAGGAGGTGG + Exonic
1103934004 12:124465837-124465859 GGGGCTGCCACTTTAGGTGCTGG - Intronic
1104710776 12:130984312-130984334 GCGGCTGCCCCATCACGAGGTGG - Intronic
1104749585 12:131229857-131229879 GGGCCTGCTCCATCAGGAGGAGG + Intergenic
1104783848 12:131437460-131437482 GGGGCTGCTCCATCAGGAGGAGG - Intergenic
1104979623 12:132568028-132568050 GGGGCTACCCCCTCTGGAGAGGG - Intronic
1109001622 13:56812172-56812194 GGGGCTTCTCCCACAGGAGGTGG + Intergenic
1113744591 13:112734818-112734840 GGGGTTGCTGCCTCAGGAGGAGG - Intronic
1116902840 14:50378206-50378228 GCAGGTGCCTCCTTAGGAGGGGG + Intronic
1119416631 14:74474738-74474760 GGAGCTGCCCACTCAGGATGAGG + Intergenic
1121354727 14:93204945-93204967 GGTGTTGCGCCTTTAGGAGGTGG - Intronic
1122059057 14:99124545-99124567 GGAGCTGCCCACTGAGGAGAAGG + Intergenic
1122204740 14:100142885-100142907 GGGGCTGCACCCACAGCAGGTGG - Intronic
1122264111 14:100538710-100538732 AGGGCTGCCCTCGTAGGTGGTGG + Exonic
1122365982 14:101195092-101195114 GAGCCGGCCCCCTTAGGAAGGGG + Intergenic
1122940991 14:104981301-104981323 GGGGCTGCCCACTTCCAAGGTGG + Intergenic
1123014078 14:105365268-105365290 GTGGCTGGCCCCTTGGCAGGAGG + Intronic
1123493874 15:20803780-20803802 GGGGCAGCTACCTTAGCAGGTGG + Intergenic
1123550372 15:21372862-21372884 GGGGCAGCTACCTTAGCAGGTGG + Intergenic
1123680283 15:22757973-22757995 GGGGCTGCCAGCGTCGGAGGAGG + Intergenic
1123710088 15:22980477-22980499 GGGGATGCCCCGCCAGGAGGAGG - Intronic
1124332496 15:28832439-28832461 GGGGCTGCCAGCGTCGGAGGAGG + Intergenic
1124404869 15:29383681-29383703 GGTTCTGCCCCCTGTGGAGGTGG - Intronic
1126809284 15:52384242-52384264 GGGTGTGCGCCCTGAGGAGGTGG + Exonic
1129235950 15:74223899-74223921 GGGGCTCCCCCTTGAGTAGGGGG + Intergenic
1129862474 15:78873149-78873171 CGGGCTGCGCCCTGAGAAGGCGG + Intronic
1202958715 15_KI270727v1_random:100116-100138 GGGGCAGCTACCTTAGCAGGTGG + Intergenic
1132992923 16:2806344-2806366 GGGGCTGACCTATTAGCAGGCGG + Intergenic
1133040650 16:3058476-3058498 GGGGCTGCCCCCGGGAGAGGAGG + Exonic
1133076083 16:3282512-3282534 GGGGCTGCCCAGTTGTGAGGCGG - Intronic
1134562018 16:15219050-15219072 TGGGCAGCACCCTGAGGAGGGGG - Intergenic
1134922556 16:18130676-18130698 TGGGCAGCACCCTGAGGAGGGGG - Intergenic
1137252362 16:46749371-46749393 AGGGCTGCCCCCAAGGGAGGGGG + Intronic
1137327773 16:47459666-47459688 GAGGATGGCCCCATAGGAGGAGG - Intronic
1138360181 16:56421960-56421982 GGAGAGGCCCCCTTGGGAGGAGG + Intronic
1140219700 16:73034705-73034727 GGGGCTGTCCCCTGAGGAGGTGG + Intronic
1142174508 16:88639037-88639059 GGGGGTGCCCCCTGAGGGAGGGG - Exonic
1142249338 16:88983932-88983954 GGGGCTTCCCCCTTTGCAGCTGG - Intergenic
1142279682 16:89141413-89141435 GGGGCCGCCCCTTTGGGTGGGGG + Intronic
1142571985 17:880723-880745 AGCCCTGCCCCCTTAGGAGAAGG - Intronic
1143590621 17:7884591-7884613 GGGGCCGCCGTCTGAGGAGGGGG - Intronic
1146534637 17:33639564-33639586 GGAGCTGCCTCCTTGGGAGTGGG + Intronic
1147393315 17:40122791-40122813 GGGGCTCCCGCCCTGGGAGGAGG - Intronic
1147722646 17:42548346-42548368 GGCGCAGCACCCTGAGGAGGTGG + Intergenic
1148080836 17:44967121-44967143 GGGGCTTGCCCCTTGGGAAGTGG - Intronic
1148565545 17:48630978-48631000 GTGGCTGACTCCTTGGGAGGGGG + Intronic
1148623377 17:49051354-49051376 GGGGCTGCCCCCTTAGGAGGAGG + Exonic
1148685231 17:49497106-49497128 GCGGCTGCCCCCTGAAAAGGTGG - Intronic
1148768902 17:50055929-50055951 GGTGCTGCCCCTTTAAGAGGAGG + Intergenic
1152167843 17:78722486-78722508 GAGCCTGCCCCCTTGGGAGGAGG - Intronic
1152524359 17:80879174-80879196 AGGGCTGCCCACTGAAGAGGTGG - Intronic
1153836769 18:8970581-8970603 GGATCTGCCCCCTCAGGATGGGG - Intergenic
1154451395 18:14478238-14478260 GGGGCAGCTACCTTAGCAGGTGG + Intergenic
1159143196 18:64421922-64421944 GAAGCTGCCCCTTTAGAAGGAGG - Intergenic
1160330969 18:77991482-77991504 GGGGCTGCTCACATAGGAGTGGG + Intergenic
1160586697 18:79917233-79917255 GGGGCTGCCCCGTCAGCTGGGGG - Intronic
1160673143 19:375763-375785 GGAGCTTCCCCCCGAGGAGGTGG - Exonic
1160864802 19:1251917-1251939 AGGGCTGCCCTGTTAGGAAGGGG - Intronic
1160877301 19:1302689-1302711 TGGGCTGCCTCATTAGGAGGCGG - Intergenic
1161769681 19:6224359-6224381 GGGGGTGTCCCCTTGGGAGCTGG + Intronic
1162396421 19:10420380-10420402 GGGGCAGCTACCTAAGGAGGGGG - Intronic
1163491462 19:17619359-17619381 GGGGATGCTCCTTGAGGAGGAGG - Intronic
1163507937 19:17719438-17719460 GGTGCGGCCCCTTTAAGAGGCGG + Exonic
1164242986 19:23406671-23406693 CACGCTACCCCCTTAGGAGGAGG + Intergenic
1164750828 19:30653682-30653704 GGAGCCGCTCCCTTAGGAGCAGG + Intronic
1165431490 19:35775835-35775857 GGGGATGCGCGCTTAGGGGGCGG - Intronic
1166133786 19:40763172-40763194 GGGCAGGCCCCCTGAGGAGGTGG + Intronic
1168474684 19:56667364-56667386 GGGGCTAGCCCCAGAGGAGGGGG + Intronic
926285073 2:11482266-11482288 AGGGCAGCCCCCGTAAGAGGAGG + Intergenic
927890054 2:26742556-26742578 TGGGCTGACCCCATGGGAGGTGG - Intergenic
928102971 2:28450122-28450144 TGTGCTGCCCCCAGAGGAGGGGG - Intergenic
931147334 2:59533649-59533671 GGGGCTGCTGCCTAAGGATGGGG + Intergenic
933713721 2:85345342-85345364 GGAGCTGCTCCCTGAGGAGCCGG - Intronic
936403474 2:112183327-112183349 GGTGCTGCCCCTTTCAGAGGTGG - Intronic
937418778 2:121737913-121737935 GGAGGGTCCCCCTTAGGAGGTGG + Intronic
937425383 2:121794738-121794760 AGGGCTCCCTCCTTAGGAGCAGG + Intergenic
941088511 2:161146963-161146985 GGGGCTGAGCCCCTAGGGGGAGG - Intronic
941183219 2:162286563-162286585 GGGGCTGCATGCTTTGGAGGAGG + Intronic
943514077 2:188862770-188862792 GGGCCTGAGCCCTTAGGGGGAGG + Intergenic
943661490 2:190563890-190563912 GGGGCTGGCCCCAGGGGAGGCGG + Intergenic
1168819682 20:764469-764491 GGGGCTCTCCCCTTAGGTGGGGG - Intronic
1168819698 20:764508-764530 GGGGCTCTCCCCTTAGGTGGGGG - Intronic
1169820886 20:9708747-9708769 AGGGCTGCTCCCTTAGGTGGAGG - Intronic
1169914351 20:10672116-10672138 GGGGCGGCCGCCGCAGGAGGAGG - Intronic
1170880128 20:20289680-20289702 GGGGCTGCCTAGTTAGGAAGAGG - Intronic
1171258593 20:23710941-23710963 TGGGCTGCTCCCTTTGGAAGAGG + Intergenic
1171265911 20:23772403-23772425 TGGGCTGCTCCCTTTGGAAGAGG + Intergenic
1172015583 20:31870686-31870708 GGGGCCGCCACCTCCGGAGGTGG + Exonic
1172467378 20:35166315-35166337 GGCACTTCCCCCTTAGGATGAGG - Intergenic
1172931685 20:38591067-38591089 GGGGTTGCCTCCTCAGCAGGTGG - Intergenic
1174973587 20:55305732-55305754 GGGCCTGCGCCCCTAGGGGGAGG + Intergenic
1175067354 20:56300820-56300842 GCGGCTGCCCCCTTTAGAGGGGG + Intergenic
1175777050 20:61660036-61660058 GGAGCTGCCCCCTTGGGAGCGGG - Intronic
1175780036 20:61676471-61676493 GGGTCTACCCCTTTAGGAGCAGG + Intronic
1175967803 20:62668350-62668372 GGGGCTTCCCACTTGGGGGGGGG + Intronic
1176124668 20:63470161-63470183 GAGGCGGCCCCTTTGGGAGGGGG - Intronic
1176380501 21:6110359-6110381 GGGGCTGCCCCCGCAGCATGTGG - Intergenic
1176444748 21:6811989-6812011 GGGGCAGCTACCTTAGCAGGTGG - Intergenic
1176822915 21:13677024-13677046 GGGGCAGCTACCTTAGCAGGTGG - Intergenic
1177162728 21:17565600-17565622 GGGGCAGCTACCTTAGCAGGTGG - Exonic
1178424368 21:32467585-32467607 GGGGCTGCACCCTGAGAAGGGGG - Intronic
1179478164 21:41660995-41661017 GGGGCTGCCTCTTTAGGAGGTGG + Intergenic
1179742971 21:43427881-43427903 GGGGCTGCCCCCGCAGCATGTGG + Intergenic
1180955380 22:19739060-19739082 GTGGCTGACCCCTGAGGAGCGGG - Intergenic
1181031675 22:20151047-20151069 GGGGCAGCCCCCTCAGTAAGAGG - Intergenic
1181595851 22:23913951-23913973 CGCGCTGCTCCCTTAGGAGGCGG - Intergenic
1181623564 22:24107067-24107089 GGTGCTGCCCCCTTGGTAGTGGG + Intronic
1182293692 22:29300806-29300828 GGGGCTGCTCCCTCAGGTGAGGG + Intergenic
1182360903 22:29745872-29745894 GGGGCAGCCTCCTGAGGAAGTGG + Intronic
1183689910 22:39382714-39382736 GGGGCTGTCCCCAGGGGAGGAGG - Exonic
1184240797 22:43210407-43210429 TGGGCTGCCCCCAGAGCAGGAGG + Intronic
1184425071 22:44404396-44404418 GGGGCTGCTCTGTTTGGAGGTGG - Intergenic
1184465977 22:44669020-44669042 GGGGCGGCCCCCTTGGGTGAAGG + Intronic
1184477365 22:44728925-44728947 AGGGCTGCCTCCCTAGGAAGGGG + Intronic
1184676847 22:46048040-46048062 GTGGCTGCCTTGTTAGGAGGTGG - Intergenic
1184998704 22:48228584-48228606 AGGGCTGGCCCCTGAGGAGGTGG - Intergenic
1185038549 22:48491839-48491861 GGGGAGGCCTCCTAAGGAGGAGG - Intronic
949934485 3:9106352-9106374 GGAGCTGCCACCTCAGGTGGTGG - Intronic
952983819 3:38759799-38759821 GGGGCTGTCCCCTTTAGAGGAGG + Intronic
953388326 3:42519763-42519785 GGGGGAGCCCCTTTAGGAGGTGG + Intronic
954414012 3:50384141-50384163 GGGCCTGCCCCCACAGCAGGTGG + Intronic
955903798 3:63785590-63785612 GTGGCTACCCACTTAGGAGATGG + Intergenic
960587730 3:119335652-119335674 GGGTCTGCACTCTGAGGAGGAGG + Intronic
961367059 3:126406731-126406753 GTGGCAGCTCCCTGAGGAGGTGG + Intronic
961528681 3:127526182-127526204 GGGGCTGGCTTCCTAGGAGGTGG + Intergenic
961832593 3:129631879-129631901 GGAGCTGCCCCCTGAGGTGTGGG + Intergenic
962316511 3:134362812-134362834 CAGGCTGCCCCCTGAGGAGCAGG + Intronic
962318081 3:134371106-134371128 GGAGCTGCCCACCTATGAGGAGG - Exonic
968816343 4:2823729-2823751 GGGGCTGGGCCCTTAAGGGGTGG - Intronic
968992177 4:3921871-3921893 AGGGCTGCACCCTGAGAAGGGGG + Intergenic
969823167 4:9735805-9735827 GGGGCTGCACCCTGAGAAGGGGG - Intergenic
970434473 4:16020097-16020119 GGGGCTGAGCTCTTAGGAGATGG + Intronic
970453102 4:16191396-16191418 CGGACTGCCCCCTTATCAGGTGG + Exonic
977609853 4:99020502-99020524 GGGACTACCACCTGAGGAGGAGG + Intronic
981331483 4:143514491-143514513 GGAGATGACCCCTTAGGAGCGGG + Intronic
985541187 5:488510-488532 GGGCCTGCCACCCGAGGAGGAGG + Intronic
986391278 5:7289953-7289975 GGGGCTGCCAGCGTCGGAGGAGG + Intergenic
987079918 5:14417457-14417479 GGGGCTGCCCCCTTGTGCTGAGG - Intronic
988059534 5:26149059-26149081 GGGCCTGAGCCCTTAGGAGTAGG + Intergenic
995080699 5:108047797-108047819 GGGCCTGAGCCCCTAGGAGGAGG + Intronic
998951332 5:147395638-147395660 GGGGGTGCCACCTTTGGGGGTGG + Exonic
1000170170 5:158694422-158694444 GGGCCTGGCCCCTTAGGCAGAGG - Intergenic
1003133949 6:3418628-3418650 TGGGCTTCCCCCTGGGGAGGGGG + Intronic
1003687069 6:8314979-8315001 GGGCCTGATCCCCTAGGAGGAGG - Intergenic
1006079805 6:31558637-31558659 GGGGCTGCAGCCTCAGGATGAGG + Exonic
1006133446 6:31882234-31882256 GGGACAGGCCCCTGAGGAGGTGG + Intronic
1006837174 6:37005979-37006001 GGGGCTGCCCCTGCAGGAGGAGG - Intronic
1007093799 6:39200947-39200969 GGGGCTTCCCCTTTACGGGGTGG + Intronic
1007583662 6:42975068-42975090 GAGCCTGCCCCCTTAGGAGAAGG - Intronic
1013457127 6:110340292-110340314 TGGGCTGAACCCTCAGGAGGTGG - Intronic
1014384065 6:120779613-120779635 TTGGCTGCTCCCATAGGAGGGGG - Intergenic
1015439210 6:133228413-133228435 GGGGCTGCCCAATTAGTAGGAGG - Intergenic
1017000910 6:149996415-149996437 GGGGCTGCCTGCAGAGGAGGAGG + Intergenic
1018854612 6:167666599-167666621 GACGCTGCCCCTTTCGGAGGTGG + Intergenic
1019395589 7:816358-816380 GGGGCTGCACCTGGAGGAGGGGG - Intergenic
1020013947 7:4820458-4820480 GGGGCTGCCCCATCACGTGGGGG + Intronic
1020130464 7:5556251-5556273 GGGCCTGACCCCCTAGGGGGAGG + Intronic
1020136979 7:5593080-5593102 GGAGCAGCCCCCTGACGAGGCGG + Exonic
1023659819 7:42460139-42460161 GGGTAAGCCCCCGTAGGAGGAGG - Intergenic
1024709060 7:51995413-51995435 GGGGCTGCCCCTATGGAAGGGGG - Intergenic
1025307630 7:57877889-57877911 GGGGCTGAGCCCTTAGGAATGGG + Intergenic
1026878472 7:73893519-73893541 GGGACAGCCCCCGCAGGAGGAGG + Intergenic
1034404766 7:150896125-150896147 CTGGCTGCCCTCTTAGAAGGGGG - Intergenic
1034414947 7:150959437-150959459 GGGGGTCCCCCCTTTGGAGGTGG - Intronic
1036299224 8:7558839-7558861 GGTGCTGCCTCCTAAGGAGATGG - Intergenic
1036300529 8:7566489-7566511 GGTGCTGCCTCCTAAGGAGATGG - Intergenic
1036324653 8:7769827-7769849 GGTGCTGCCTCCTAAGGAGATGG + Intergenic
1037801280 8:22037213-22037235 GGGGCTGGCCCCCTAGGGCGAGG - Intergenic
1040294045 8:46140046-46140068 GGAGATGCCTCCTTAGGAGGCGG + Intergenic
1040582165 8:48707100-48707122 AGGCCTGCCCACTTAGGACGCGG + Intergenic
1041898974 8:62959750-62959772 GGGGCTCCACCCTTAGTAGTGGG - Intronic
1049159205 8:141086582-141086604 GGGGGTGCCCCCTGTGCAGGGGG - Intergenic
1049254709 8:141607659-141607681 GGGGCTGCCCAGTGAGAAGGAGG - Intergenic
1049386899 8:142347413-142347435 GGCCCTGCCCTCTTGGGAGGGGG - Intronic
1049612357 8:143561523-143561545 CGGGCAGCCCCCTGAGGCGGTGG + Intronic
1051264823 9:15300262-15300284 GGTGCTGTCCCCTAAGGAGAAGG - Intronic
1051433478 9:17005183-17005205 GAGGCTGCCCTCTTTGGAGATGG + Intergenic
1052115712 9:24646472-24646494 GGGCCTGAGCCCCTAGGAGGAGG - Intergenic
1053139544 9:35674092-35674114 GAGGATTCCCCCTTGGGAGGAGG + Exonic
1056053791 9:82799307-82799329 GTGGCTGCCCTCTTAGGTGTTGG + Intergenic
1056665012 9:88574705-88574727 GGGGCTGGATCCTTAGGAAGAGG + Intronic
1057741075 9:97711560-97711582 GGCGCTGCCGCCAGAGGAGGGGG + Intergenic
1057900100 9:98942170-98942192 GGGGCTGCGGCCTGTGGAGGGGG - Intergenic
1059348568 9:113648853-113648875 GAGGTTGCCCCACTAGGAGGTGG + Intergenic
1061789994 9:133054289-133054311 GGGGTTGCCCTCTCAGGAGCTGG + Intronic
1062381607 9:136289606-136289628 GGGGCTGCCTCCTGAGGGTGGGG + Intronic
1062411879 9:136429869-136429891 GGGGCCGGCCCCGGAGGAGGGGG + Intronic
1062573491 9:137196029-137196051 AGGGCTGCACCCCTCGGAGGCGG + Intronic
1203524450 Un_GL000213v1:72538-72560 GGGGCAGCTACCTTAGCAGGTGG + Intergenic
1187249294 X:17582472-17582494 GGGGTTGTCCAGTTAGGAGGTGG + Intronic
1188061391 X:25606101-25606123 AGGGCTGCCCCCATGGGAGGGGG - Intergenic
1190261764 X:48802079-48802101 GGGGCAGTCCCCTGAGGAGCGGG + Exonic
1190375435 X:49784331-49784353 GGGGGTGTCCCGTGAGGAGGAGG + Intergenic
1191866296 X:65706455-65706477 GGGGTGGCCCCCTGGGGAGGTGG + Intronic
1195004023 X:100669298-100669320 GGGACAGCCACCTCAGGAGGTGG + Exonic
1195672013 X:107477744-107477766 GGGGTTGCCCCCTGGAGAGGGGG + Intergenic