ID: 1148623973

View in Genome Browser
Species Human (GRCh38)
Location 17:49054862-49054884
Sequence CTCAGACTCCCCCAGGGCAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 413}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148623973_1148623985 21 Left 1148623973 17:49054862-49054884 CCTTTGCCCTGGGGGAGTCTGAG 0: 1
1: 0
2: 1
3: 37
4: 413
Right 1148623985 17:49054906-49054928 CAGGCCGTCTTTGTAGTTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 76
1148623973_1148623984 20 Left 1148623973 17:49054862-49054884 CCTTTGCCCTGGGGGAGTCTGAG 0: 1
1: 0
2: 1
3: 37
4: 413
Right 1148623984 17:49054905-49054927 TCAGGCCGTCTTTGTAGTTGGGG 0: 1
1: 0
2: 0
3: 2
4: 74
1148623973_1148623983 19 Left 1148623973 17:49054862-49054884 CCTTTGCCCTGGGGGAGTCTGAG 0: 1
1: 0
2: 1
3: 37
4: 413
Right 1148623983 17:49054904-49054926 TTCAGGCCGTCTTTGTAGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 83
1148623973_1148623982 18 Left 1148623973 17:49054862-49054884 CCTTTGCCCTGGGGGAGTCTGAG 0: 1
1: 0
2: 1
3: 37
4: 413
Right 1148623982 17:49054903-49054925 ATTCAGGCCGTCTTTGTAGTTGG 0: 1
1: 0
2: 0
3: 5
4: 47
1148623973_1148623980 2 Left 1148623973 17:49054862-49054884 CCTTTGCCCTGGGGGAGTCTGAG 0: 1
1: 0
2: 1
3: 37
4: 413
Right 1148623980 17:49054887-49054909 CGCGGTCCTTGGACTCATTCAGG 0: 1
1: 0
2: 0
3: 4
4: 39
1148623973_1148623979 -9 Left 1148623973 17:49054862-49054884 CCTTTGCCCTGGGGGAGTCTGAG 0: 1
1: 0
2: 1
3: 37
4: 413
Right 1148623979 17:49054876-49054898 GAGTCTGAGGGCGCGGTCCTTGG 0: 1
1: 0
2: 0
3: 15
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148623973 Original CRISPR CTCAGACTCCCCCAGGGCAA AGG (reversed) Exonic
900152958 1:1187651-1187673 CTCAGCCTCCCAAAGTGCAATGG - Intronic
900168105 1:1252652-1252674 CTCTAACTCCCCCGGGGAAAAGG - Intergenic
900217647 1:1490193-1490215 CTGAGATGCCCCGAGGGCAACGG - Intronic
900480186 1:2894452-2894474 CTCAGGCCTCCCCAGGCCAAGGG + Intergenic
900526784 1:3133301-3133323 GCCAGACTCTCCCAGGGCGAGGG + Intronic
901880253 1:12189649-12189671 TGCAGACTCCACGAGGGCAAGGG - Intronic
902284131 1:15395476-15395498 CTCACAGTCCCCCAGTTCAAAGG + Intronic
902786097 1:18733670-18733692 CTAAGCTTCCCCCAGAGCAAGGG + Intronic
903018323 1:20376306-20376328 CCCAGACACCCTCAGGGCATTGG - Intergenic
903264842 1:22151706-22151728 CCCAAGCTTCCCCAGGGCAATGG - Intergenic
903664706 1:24999149-24999171 CTCAGCTTCCTTCAGGGCAATGG + Intergenic
904285337 1:29450130-29450152 GTCAGACTCACCCAGGGGAGTGG + Intergenic
904465942 1:30707618-30707640 CACAGTCTCCCCCAGTGAAAGGG + Intergenic
904606528 1:31700945-31700967 CTCAGTCAGCCCCAGGGCGAGGG - Intronic
904713422 1:32448625-32448647 CTCTAACTCCCCCAGAGAAAGGG - Intergenic
905010879 1:34746313-34746335 CTCAGACTCCTCCAGGAGATGGG + Intronic
905519842 1:38589288-38589310 TGCAGACTCCCCCAGGGCCCTGG + Intergenic
907256845 1:53185803-53185825 CTCTAACTCCCCCCGGGGAAGGG + Intergenic
907294964 1:53444883-53444905 CTCTAACTCCCCCGGGGAAAGGG - Intergenic
908759199 1:67496427-67496449 CCCAGACACCCCCAGGGAAATGG - Intergenic
912681011 1:111729156-111729178 CTCAGATTCCCCAAGAGAAAGGG + Intronic
913186710 1:116375014-116375036 CCCAGACTCCATCAGGGGAATGG - Intronic
916422561 1:164650475-164650497 CTCAGACTCCCGAAGTGCTAGGG + Intronic
919903067 1:202058116-202058138 CTCAGCCTCCCAAAGTGCAAGGG - Intergenic
919922533 1:202174917-202174939 CTGGGACTCCCCCAGGGCCCTGG + Intergenic
920373827 1:205495779-205495801 CTCCGCTTCCCCCAGGGGAATGG - Intergenic
920741667 1:208586704-208586726 CTCAGGCTCCCCCAGGGCAGGGG - Intergenic
920803453 1:209210501-209210523 CTCATTATCCTCCAGGGCAAAGG - Intergenic
921188601 1:212690734-212690756 CTCAAACCCTCCCATGGCAAAGG - Intronic
923406583 1:233666913-233666935 CACATAATCCCCCAGGCCAATGG - Exonic
923428180 1:233892527-233892549 CTCACAGTCCCACAGGGCTAGGG - Intergenic
923538503 1:234871330-234871352 CTGAGACTCCACCAGGCTAAAGG + Intergenic
924728353 1:246690444-246690466 CTAAGCCTCCCCCTGGGCAAGGG - Intergenic
1062843593 10:689137-689159 CACAGACACCCCCAGGGCGCGGG + Intronic
1062843633 10:689244-689266 CACAGACACCCCCAGGGCGCGGG + Intronic
1062943169 10:1439398-1439420 CTGAGTCTCCCCCAGGACAGAGG + Intronic
1062943327 10:1440128-1440150 CTGAGTCTCCCCCAGGACAGAGG + Intronic
1064105757 10:12499824-12499846 GTCAGTCTCCCCCAGAGCTATGG - Intronic
1065899295 10:30190744-30190766 CTCTGACTCCCCCCAGGGAAAGG - Intergenic
1066064037 10:31749714-31749736 CACAGACTTTCCCAGGGCAAGGG - Intergenic
1067753784 10:48988687-48988709 CTCAGAGCCCCTCAGGGCAGAGG + Intergenic
1069752227 10:70752027-70752049 CTGAGGCCCCACCAGGGCAATGG + Intronic
1069872685 10:71542818-71542840 CTGTGCCTCCCCCAGGGGAAGGG - Intronic
1069896923 10:71685687-71685709 CTCCGGCTGCCCCAGGGCCAGGG - Intronic
1069941158 10:71956344-71956366 CTCTAACTCCCCCAGGGAAGGGG - Intergenic
1070069278 10:73070928-73070950 CTCAGCCTCCCACAGCGCTAGGG - Intronic
1070675472 10:78408792-78408814 CCAAGACTCACCCAGGACAAGGG - Intergenic
1070965684 10:80528943-80528965 GCCAGACTCCCCCAGGCCAGGGG - Exonic
1071292147 10:84195711-84195733 CTCCGAATTCCCCTGGGCAATGG + Intronic
1071464034 10:85923376-85923398 CTCAGCCTCCCCCAGAGCTGTGG - Intronic
1072417966 10:95264591-95264613 CTCAGTCTCCTGCAGAGCAAGGG + Intronic
1072801350 10:98394371-98394393 CCCAAATTCCCCCAGGGCGATGG - Intronic
1074309268 10:112308274-112308296 CTTTGCCTCCCACAGGGCAAAGG - Intergenic
1074974222 10:118567253-118567275 ATCAGACCTCCCCAGGGCAGTGG + Intergenic
1076722819 10:132400193-132400215 CTCTCACTCCCCAAGGGCAGGGG - Intronic
1076871898 10:133198589-133198611 CTCGGACTCCTCCTGGGCCAAGG - Exonic
1076946800 10:133657155-133657177 CTCCTAATCCCCCAGGACAAAGG + Intergenic
1077011804 11:382154-382176 CTCAGGGTCCCCCAGGGGAGAGG - Intergenic
1077264981 11:1644108-1644130 TCCAAACTCCCCCGGGGCAAGGG - Intergenic
1077388347 11:2286434-2286456 TCCAAACTCCACCAGGGCAAGGG + Intergenic
1077465207 11:2730693-2730715 ATCCGCCTCCCCCAGGGTAATGG - Intronic
1077520076 11:3027880-3027902 TCCAGACTCCCGCGGGGCAAGGG - Intronic
1077706662 11:4493287-4493309 CTCTAACTCCCCCAGGGAAAGGG + Intergenic
1077866938 11:6230201-6230223 CTTTGCCTCTCCCAGGGCAAAGG - Intronic
1080752081 11:35160029-35160051 CTCACTCTCCCCAGGGGCAATGG + Intronic
1083194724 11:61078933-61078955 CTCAGAATCCCACAAGGCAGAGG - Intergenic
1083226692 11:61289713-61289735 CACAGACACACCCAGGGAAAAGG + Intronic
1083502962 11:63128413-63128435 CTCTAACTCCCCCAGGGAAAGGG - Intronic
1084217727 11:67659459-67659481 CTCTAACTCCCCCAGGAAAAGGG + Intergenic
1088108814 11:106237126-106237148 TACAAACTCACCCAGGGCAAAGG + Intergenic
1088559447 11:111097797-111097819 CTCAGACTCCACCAGAGCGAGGG - Intergenic
1088869400 11:113878244-113878266 CTCAGACTCCCCTGGGACTAAGG + Intergenic
1090277764 11:125431781-125431803 CTAAGTCTGCCCCCGGGCAAAGG - Exonic
1091193421 11:133713080-133713102 CTCTGACTCCCACAGGGCTCTGG - Intergenic
1091781504 12:3216940-3216962 CTCAGCTTCCCCCAGGACAGTGG - Intronic
1091979085 12:4851048-4851070 TGCAGACCCCCCCAGGACAAGGG + Intronic
1093643456 12:21554928-21554950 CTCAGTCTTCCCAAGGCCAAGGG + Intronic
1094368929 12:29714786-29714808 CTCAGACTCCCCAGGGAAAAAGG + Intronic
1095212397 12:39509587-39509609 CTCAGACTCCCCAAAGGTCAAGG - Intergenic
1095945104 12:47749228-47749250 CTCACACACACCCAGGGCTATGG + Intronic
1096258934 12:50078988-50079010 CCCAGACTGCCCCAGGCCAGGGG - Intronic
1096453834 12:51769253-51769275 GTCAGACTCGCCCACAGCAATGG - Exonic
1096694166 12:53338280-53338302 CTCAGACTCCCCCCCAACAAGGG - Intronic
1097238109 12:57553473-57553495 ATGAGACTCCCCCAAAGCAAAGG - Intronic
1098247082 12:68530975-68530997 CTTATAGTCCCCTAGGGCAAGGG - Intergenic
1101825880 12:108219668-108219690 CTCAGACCCCACCAGGGTAGTGG + Intronic
1102148530 12:110672465-110672487 CTCACACACCCACAGGGAAAGGG + Intronic
1105287111 13:19013467-19013489 CTCTAACTCCTCCAGGGAAAGGG - Intergenic
1109290907 13:60473926-60473948 CTCTAACTCCCCCAGGGAAAGGG - Intronic
1110196523 13:72794727-72794749 CTCAGACTTCCACATGGCAGGGG - Intronic
1111657897 13:91175323-91175345 CCCAGACTCCCACGGGGAAACGG + Intergenic
1111782101 13:92741353-92741375 CTCAGAGCCTCCCACGGCAAAGG - Intronic
1112040719 13:95545027-95545049 CTCAGCCTCCCAAAGGGCTAGGG + Intronic
1113542656 13:111121213-111121235 TGCAGGTTCCCCCAGGGCAAGGG - Intronic
1113738873 13:112697206-112697228 CTCTGCCTTCCCCAGGGCCACGG + Intronic
1116045718 14:39740373-39740395 CTGAGTCTCACCCAGGGCCAAGG - Intergenic
1117632598 14:57709155-57709177 TCTAGACTCCCCCAGGGAAAGGG + Intronic
1118113999 14:62753546-62753568 ATCAAACTCCCACAGGCCAAGGG + Intronic
1118936144 14:70290179-70290201 CTCTGACTCCCCCTGGCAAATGG - Intergenic
1119029498 14:71180751-71180773 CTCAGACAGCCCCAGAGCACAGG + Intergenic
1119214129 14:72855683-72855705 CTCAGAGTCCCACTGGCCAAGGG + Intronic
1119726554 14:76924990-76925012 CACAGACTGGCCCAGGTCAAGGG - Intergenic
1120861282 14:89257101-89257123 GTGAGAGTCCCCCAGGGCTAGGG + Intronic
1121482817 14:94291630-94291652 CCCAGACCCTCCCAGGGCAGTGG - Intronic
1121488929 14:94343983-94344005 CTGAGACTCCACCAGGGAACAGG - Intergenic
1122056018 14:99098899-99098921 CCCCGACTCCCCCACGGCACAGG + Intergenic
1122487549 14:102091255-102091277 CTCAGGGTCACCCAGAGCAAGGG + Intronic
1122652617 14:103233725-103233747 CTCAGCCTCACCCAGGACACAGG - Intergenic
1123188137 14:106539782-106539804 CTCTAACTCCCCCGGGGAAAGGG - Intergenic
1202920879 14_KI270723v1_random:29710-29732 CTCCTAATCCCCCAGGACAAAGG + Intergenic
1202924037 14_KI270724v1_random:7871-7893 CTCCTAATCCCCCAGGACAAAGG - Intergenic
1124421924 15:29530243-29530265 CTGAGCCTCGCCCAGAGCAATGG + Intronic
1124504620 15:30262065-30262087 CTGAGATTCCCCCAGGGCCTCGG - Intergenic
1124738932 15:32276570-32276592 CTGAGATTCCCCCAGGGCCTCGG + Intergenic
1124808669 15:32911785-32911807 CTCAGATTCCACCAAGACAAAGG + Intronic
1125646596 15:41277838-41277860 CTCAGCCTCCCCCAAGGAACTGG - Intronic
1125760255 15:42091586-42091608 CTCTAACTCCCCCGGGGAAAGGG - Intronic
1126061230 15:44784723-44784745 CTCTAACTCCCCCGGGGAAAGGG + Intergenic
1128106806 15:65051355-65051377 CTGGGAGTGCCCCAGGGCAAGGG + Intronic
1128262080 15:66239624-66239646 CCCAGCCTCCCCCAGGGTGAGGG + Intronic
1128548787 15:68584564-68584586 CACAGCCTCCGCCAGGGCCAGGG + Intronic
1128686015 15:69686156-69686178 ATCAGACACCCCCAGGGGAATGG + Intergenic
1129504737 15:76071831-76071853 CTCAGTCTTACCCAGGGCAGGGG + Intronic
1130013852 15:80172866-80172888 GTCAGGCTGCCCCAGGACAAAGG - Intronic
1130983432 15:88828647-88828669 CTCAGCCTCCCTCATGGCCAGGG - Intronic
1131522380 15:93126280-93126302 CTCAGCTTCCACCAGGGCACTGG - Intergenic
1133467696 16:6043632-6043654 AACAGACTCCCCCTGGGCCAAGG - Intronic
1134026523 16:10958236-10958258 CAGGGACTCCCCCAGGGCACAGG - Intronic
1134100318 16:11447362-11447384 CACAAGCTCCCCAAGGGCAAAGG + Intronic
1135202129 16:20446591-20446613 CTCAGAATTTCCCAGGGCAGGGG - Intergenic
1135216975 16:20581275-20581297 CTCAGAATTTCCCAGGGCAGGGG + Intergenic
1136233633 16:28902195-28902217 CTCAGGCAGCCCCAGGGCAGCGG - Exonic
1136671169 16:31859684-31859706 CTCTAAATCCCCCAGGGAAAGGG - Intergenic
1138088963 16:54158708-54158730 CTCAGACTTCCCCATCTCAATGG + Intergenic
1138594507 16:58022633-58022655 CACATCCTCCCCCAGGGGAATGG - Intergenic
1141731435 16:85825528-85825550 CTCAGCATCCCCCAGGCCAGGGG + Intergenic
1141890984 16:86926364-86926386 CCCAGCCTCCCACAGGGCACTGG + Intergenic
1142052309 16:87966859-87966881 CTCAGACTTCCTCAAAGCAAAGG - Intronic
1142239509 16:88938810-88938832 CTCAGCCTCCCACAGTGCCAGGG - Intronic
1142426682 16:90005375-90005397 CCCAGACACCCCCAGAGCAGAGG + Exonic
1142546648 17:708611-708633 CTCTAACTCCCCCAGGGAAAGGG + Intronic
1143404268 17:6666690-6666712 CTCAGCCTCCCAAAGTGCAAAGG + Intergenic
1143641999 17:8204496-8204518 CTCAGACTCCCACAGCCCAGGGG - Intergenic
1143718823 17:8796164-8796186 CCCAAACTCCCCCAGGGGAAGGG - Intergenic
1144581680 17:16462852-16462874 CTCAGAAACCCCCAAGGCAAAGG - Intronic
1146169943 17:30625176-30625198 CTCAGGCTCTCCGAGGTCAAAGG - Intergenic
1146343396 17:32041206-32041228 CTCAGGCTCTCCGAGGTCAAAGG - Intronic
1146548691 17:33761813-33761835 CTAAGACCTCCCCAGCGCAAGGG + Intronic
1146761233 17:35481252-35481274 CTCTAACTCCCCCGGGGAAAGGG - Intronic
1147660733 17:42115545-42115567 CTCATTCTCCCCTGGGGCAATGG + Intronic
1147838343 17:43351317-43351339 CTCTAACTCCCCCAAGGAAAGGG + Intergenic
1148203019 17:45762531-45762553 CTAAGTCTCCCCCAGGGGCAAGG - Intergenic
1148623973 17:49054862-49054884 CTCAGACTCCCCCAGGGCAAAGG - Exonic
1148903876 17:50899277-50899299 CTCTGGCTTCCCCAGGGCACAGG + Intergenic
1151284031 17:73096921-73096943 GCCTGACGCCCCCAGGGCAAAGG + Intergenic
1151614882 17:75203296-75203318 CTCAGACTCCCAAAGTGCTAGGG - Intergenic
1152694758 17:81738559-81738581 CTCAGTGTCCCCCTGGGCCAGGG - Intergenic
1152741404 17:82020024-82020046 CTGAGCCTCTCCCAGGGCAGGGG + Intronic
1203170728 17_GL000205v2_random:146147-146169 CTCCTAATCCCCCAGGACAAAGG + Intergenic
1153492550 18:5664332-5664354 CACATACTCCCCCCAGGCAAAGG - Intergenic
1160519581 18:79496868-79496890 CTCAGTTTCCCCCCGGGAAAGGG - Intronic
1161029816 19:2052314-2052336 CTCAGCCACCCCCGGGGCATTGG + Intergenic
1161033502 19:2071191-2071213 CTCTGTCTCCCCCAGGGCTCGGG - Exonic
1161080381 19:2307515-2307537 TTCAGACGCCCCCAGAGCAGGGG + Intronic
1161454348 19:4362658-4362680 CTCAGGCTCTCCAAGGTCAAAGG + Exonic
1161509031 19:4660491-4660513 CACAGACGCCCCCAGGCCAGGGG - Intronic
1162089409 19:8269155-8269177 CTCTAACTCCCCCAAGGAAAGGG - Intronic
1162236307 19:9312371-9312393 CTCTAACTCCCCCGGGGAAAGGG - Intergenic
1162382515 19:10339823-10339845 CTGAGTCTCCCCCAGGGAATGGG + Exonic
1162518719 19:11166444-11166466 CTCACACTCCCCAAGGCCCACGG - Intronic
1162567649 19:11453132-11453154 CTCAGCCTCCCCCTGGGCCGAGG - Exonic
1162638569 19:11988950-11988972 CTCTAACTCCCCCGGGGAAAGGG + Intergenic
1163075673 19:14888916-14888938 CTCTAACTCCCCCGGGGAAAGGG + Intergenic
1163456299 19:17407793-17407815 TCCAAACTCCCCCAGGGAAAAGG + Intronic
1163992108 19:21008353-21008375 CTCTAACTCCCCCGGGGAAAGGG - Intergenic
1164510040 19:28889322-28889344 CAGAGACTCCTCCATGGCAAGGG + Intergenic
1164753409 19:30672225-30672247 CACAGACTCCTCCAGGGGATGGG - Intronic
1165915811 19:39258802-39258824 CTCTAACTCCCCCAGGGAAAGGG + Intergenic
1166313319 19:41975496-41975518 CTCAGGCTCCTCCAGGGCCAGGG + Intronic
1166584714 19:43935399-43935421 CTCAGAATCCCCAAGGGGAGCGG + Intergenic
1166915031 19:46189472-46189494 CTCTAACTCCCCCGGGGAAAGGG + Intergenic
925278030 2:2664073-2664095 CTCAGACACACACAGGGCATGGG + Intergenic
925934901 2:8747138-8747160 CACAGACTCCTCGAGGGTAATGG - Exonic
926814503 2:16786972-16786994 CTCATACTCCCTCAGGGCTATGG + Intergenic
927465882 2:23336108-23336130 GTCAGACAAACCCAGGGCAAAGG + Intergenic
927510833 2:23642803-23642825 CTCATACTTCCCCACGCCAATGG - Exonic
929776776 2:44935111-44935133 CCCAGAGACCCCCAGGGGAAGGG + Intergenic
932434863 2:71697292-71697314 CTCAGACACCCCTAGGCAAAAGG + Intergenic
932574269 2:72954284-72954306 CTAAGAGTCTCCCAGGGCCAGGG - Intronic
933834351 2:86233088-86233110 CTCAGACAGACCCAGGGCCAAGG + Intronic
935304072 2:101719760-101719782 CTCAGCCTCCCCAAGTGCACTGG - Intronic
936144404 2:109970156-109970178 CTCTAACTCCCCCAAGGAAAGGG - Intergenic
936181087 2:110268116-110268138 CTCTAACTCCCCCAAGGAAAGGG - Intergenic
936200284 2:110401313-110401335 CTCTAACTCCCCCAAGGAAAGGG + Intergenic
937290948 2:120781364-120781386 CTCTGACCCCGGCAGGGCAAGGG - Intronic
939237900 2:139521075-139521097 CTTAGAAGCCCCCAGGCCAAGGG + Intergenic
941484309 2:166060417-166060439 CTCATATTCCCCCACAGCAAAGG - Intronic
941928199 2:170916392-170916414 TCCAAACTCCCCCAGGGAAAGGG - Intergenic
943233747 2:185291361-185291383 CTCTAACTCCCCCTGGGGAAAGG - Intergenic
944474430 2:200089218-200089240 CTCTGGCTCTCCCAGGGCAAAGG - Intergenic
945051606 2:205829053-205829075 CTCAGTTTCCCCCAGTGGAAAGG + Intergenic
948538062 2:238662236-238662258 CTCAGCCTCCCACAGTGCTAAGG - Intergenic
949009833 2:241672104-241672126 CTCAGTCTGCCCCACGCCAAGGG + Intronic
1168967394 20:1907165-1907187 CTCAGAGCTACCCAGGGCAAGGG + Intronic
1169556918 20:6761113-6761135 CTCATACTCCCCCATGTTAAGGG + Intergenic
1170847095 20:19971477-19971499 CACAGATTCCCCCAAGGCAATGG - Intronic
1171940345 20:31322866-31322888 CTCAGAATCCACCAGAGCAATGG + Intergenic
1172010267 20:31842389-31842411 CGCACATTCCCCCAGGGCAAGGG + Intergenic
1172168165 20:32911586-32911608 CTCTGACTCATCCAGGGCCATGG - Intronic
1172222677 20:33284559-33284581 CTCACACTGCTCCAGGGCACAGG + Intronic
1172352715 20:34255894-34255916 CTCTAACTCCCCCGGGGAAAGGG - Intronic
1172520000 20:35560193-35560215 CTCCGCCTCCTCCAGGGCAAAGG + Intergenic
1172615136 20:36278339-36278361 CTCAGACCTCCCCAGGGACAAGG - Intergenic
1175536663 20:59719586-59719608 CCCACCTTCCCCCAGGGCAATGG + Intronic
1175879102 20:62246379-62246401 CTTAGACTCTCCCATGGCACTGG - Intronic
1175906843 20:62384624-62384646 CTCAGCCTCCCACAGTGCTAGGG + Intergenic
1176172375 20:63701767-63701789 CCCAGCCTCCCCCACAGCAAGGG - Intronic
1176306549 21:5126562-5126584 CTCCATCTCCCCAAGGGCAAGGG + Intronic
1176326715 21:5507978-5508000 CTCCTAATCCCCCAGGACAAAGG + Intergenic
1176330996 21:5548233-5548255 CTCCTAATCCCCCAGGACAAAGG - Intergenic
1176396761 21:6272718-6272740 CTCCTAATCCCCCAGGACAAAGG + Intergenic
1176401042 21:6312973-6312995 CTCCTAATCCCCCAGGACAAAGG - Intergenic
1176436115 21:6676131-6676153 CTCCTAATCCCCCAGGACAAAGG + Intergenic
1176440396 21:6716386-6716408 CTCCTAATCCCCCAGGACAAAGG - Intergenic
1176460377 21:7003201-7003223 CTCCTAATCCCCCAGGACAAAGG + Intergenic
1176464658 21:7043455-7043477 CTCCTAATCCCCCAGGACAAAGG - Intergenic
1176483938 21:7384979-7385001 CTCCTAATCCCCCAGGACAAAGG + Intergenic
1176488219 21:7425234-7425256 CTCCTAATCCCCCAGGACAAAGG - Intergenic
1177611347 21:23452873-23452895 CTCTAACTCCCCCGGGGAAAGGG + Intergenic
1177897535 21:26872250-26872272 CTCTGACTCCCCTGGGGAAAGGG + Intergenic
1178013089 21:28309486-28309508 CTCAGACTCCCTCACAGCTATGG + Intergenic
1179850510 21:44135468-44135490 CTCCATCTCCCCAAGGGCAAGGG - Intronic
1180155899 21:45977342-45977364 CTCAGATCCCCCCAGGGCTGTGG + Intergenic
1180992801 22:19947782-19947804 CTCTAACTCCCACAGGGAAAGGG + Intronic
1181100628 22:20536626-20536648 CTCAGTCCCTCCCAAGGCAAGGG - Intronic
1181577247 22:23802764-23802786 CTGGGACTCCCTCAGGGCAGTGG + Intronic
1182033739 22:27181357-27181379 CTCAGACTCCCCCCAGGCCTGGG + Intergenic
1182679564 22:32068202-32068224 CTCCTCCTCCTCCAGGGCAAGGG + Intronic
1182779707 22:32858079-32858101 CTCACCCTCTCCCAGCGCAAGGG + Exonic
1183849918 22:40576969-40576991 CTCAGCCTCCCAAAGTGCAAAGG - Intronic
1184021625 22:41825399-41825421 CACAGACTCCTCCAGGGTGAGGG - Intronic
1184092387 22:42299457-42299479 CTCAATTTCCCCCAGGACAAAGG + Intronic
1184163908 22:42716219-42716241 CACAGGCTCTCCCAGGGCATAGG + Intronic
1184656806 22:45946039-45946061 CCCAGAGTCCCCCAGGACCACGG - Intronic
1185271192 22:49929889-49929911 GTGGGACTCCCCCAGGGCTATGG - Intergenic
1185328735 22:50241412-50241434 CTCTAACTCCCCCAGGGAAAGGG - Intronic
950678576 3:14569425-14569447 CTGGGACTCCCCCAAGGCAGGGG - Intergenic
951671800 3:25191476-25191498 CTCAGAATCTCCCTGGTCAAAGG - Intronic
953031359 3:39182055-39182077 CACAGTCTCCCACAGGGCACAGG + Intergenic
953171832 3:40514050-40514072 CTCTAACTCCCCCGGGGAAAGGG - Intronic
954385919 3:50243795-50243817 CACAGACTCCCAAAGGGCCATGG - Intronic
955827519 3:62964211-62964233 CTCAGCCTCCCCAAGTGCTAGGG + Intergenic
956260572 3:67336087-67336109 CAAAGCCTCCCCCAGGACAAAGG + Intergenic
956660474 3:71592383-71592405 CTCAGACTCACCCAGATCAAGGG - Intergenic
957080650 3:75633261-75633283 CTCCTAATCCCCCAGGACAAAGG - Intergenic
957090346 3:75723821-75723843 CTCTAACTCCCCCGGGGAAAGGG - Intronic
959333791 3:105039266-105039288 CTAAGACACTCACAGGGCAAGGG + Intergenic
960808877 3:121609936-121609958 CTGAGTCTCCTCCAGAGCAATGG + Intronic
961178447 3:124856054-124856076 CTCAGTCTCCCCCATAGCAACGG + Intronic
961625509 3:128260479-128260501 AACAAACTCCCCCAGGGAAAAGG + Intronic
961777265 3:129297308-129297330 CTCAGTCTTCCCCAGGGCGTAGG + Intronic
962191862 3:133319184-133319206 CTCAGACTCTTCTTGGGCAAGGG - Intronic
962234983 3:133700008-133700030 CTCTGAGTCCCCCAGTGCTAAGG - Intergenic
962299406 3:134224588-134224610 CTCTAACTCCCCCGGGGAAAGGG + Intronic
962469119 3:135689499-135689521 CTCAGACACACCCAGGCCCAGGG + Intergenic
962744604 3:138388071-138388093 CTGGGACTCCCCAAGGGGAAGGG - Intronic
963129102 3:141841595-141841617 GGCAGACTACCCCATGGCAAGGG - Intergenic
966453867 3:180093506-180093528 TTCAGACCCACCCAGGGCCAGGG - Intergenic
967324263 3:188223619-188223641 GTGAGACTCCCTCAGGGCCAAGG + Intronic
968191473 3:196670868-196670890 CTCAGCCTCCCAAAGTGCAAGGG - Intronic
968284349 3:197499300-197499322 CTGAGAATCCCCCAGGGCCTGGG - Intergenic
968644033 4:1729782-1729804 CTCTAACTCCCCCAGGGAAAGGG + Intronic
968680188 4:1913335-1913357 CTCTAACTCCCCCACGGAAAGGG - Intronic
969045735 4:4335280-4335302 CTCTAACTCACCCAGGGAAAGGG + Intergenic
969310658 4:6351468-6351490 CACAGAGTCCCCAAAGGCAAAGG + Intronic
969706480 4:8794926-8794948 TTCAGAGTCCCCCAGGGGCAAGG + Intergenic
969915982 4:10492174-10492196 CTCAGAGTCTCCCATGGCTAGGG + Intronic
972780455 4:42282827-42282849 CTCAGCCTCCCCCAGTGACAGGG + Intergenic
972941944 4:44206599-44206621 CTCTGGCTCCCAGAGGGCAAAGG - Intronic
975129025 4:70813984-70814006 CTCAGGCTTCCAAAGGGCAAGGG + Intergenic
975768783 4:77698511-77698533 CACAGACTCGGTCAGGGCAAGGG + Intergenic
976324635 4:83757349-83757371 AACAGACTCCCCTTGGGCAATGG - Intergenic
978502530 4:109424359-109424381 CTCTAACTCCCCCCGGGGAAAGG - Intergenic
978547011 4:109880654-109880676 CTCAGACAACCTCAGAGCAACGG + Intergenic
981570137 4:146142959-146142981 CTTAACCTCCCCCAGGGTAAGGG + Intergenic
984305975 4:177991071-177991093 CGCATACTGCACCAGGGCAATGG + Intergenic
985450255 4:190057954-190057976 CTCCTAATCCCCCAGGACAAAGG + Intergenic
985550040 5:528331-528353 CGCAGTCCACCCCAGGGCAATGG + Intergenic
985563752 5:604860-604882 CTCAGAGTCCCTTAGGGCCAGGG - Intergenic
985683763 5:1271076-1271098 CCCAGCCACCCGCAGGGCAATGG + Intronic
988150557 5:27373044-27373066 CCCAAAGTTCCCCAGGGCAAGGG - Intergenic
988486546 5:31672441-31672463 CTCTGATTCCCCCAGGCTAATGG + Intronic
989639410 5:43568628-43568650 CTCAGATTACCCCAGGTAAAGGG + Intergenic
994446309 5:99879167-99879189 CTCACACTCCCCCAAGCCTAAGG - Intergenic
996977663 5:129454807-129454829 CTCAGCCTCCCAAAGGGCTAGGG - Intergenic
997300247 5:132798400-132798422 TTCAGACTCTCCCAAGGAAAAGG + Intronic
997610931 5:135215270-135215292 CTCAGAAACCCCCAGGGGAAGGG + Intronic
998242772 5:140463922-140463944 CTCAGCCTCCCAAAGTGCAAGGG + Intronic
998393702 5:141804684-141804706 CTGAGACTCTCCCAAGGCAGCGG + Intergenic
1002105859 5:176879208-176879230 CCCAGACTCCCCCAGAGCATGGG - Intronic
1003240065 6:4336952-4336974 CTCTAACTCCCCCAGGAAAAGGG - Intergenic
1003819290 6:9877979-9878001 CTAAGTCTTCCCCAGGTCAAAGG + Intronic
1004038191 6:11945144-11945166 CTCAAACTCCCCCTGGGCTCAGG - Intergenic
1005637817 6:27768049-27768071 CTCTAACTGCCCCAGGGCCATGG - Intergenic
1005908434 6:30286381-30286403 ATCAAACTCCCACAGGACAAGGG - Intergenic
1006563424 6:34933619-34933641 CTCAGCCTCCCAAAGGGAAAAGG + Intronic
1006830100 6:36963394-36963416 CTCAGCCTCCTCCTGGGCATGGG - Exonic
1007517966 6:42428713-42428735 CTCTGACTTCTGCAGGGCAAGGG - Intronic
1014341547 6:120213987-120214009 AGCAGACTCCTCCAGGGAAAGGG - Intergenic
1016344933 6:143103395-143103417 CATTGACTTCCCCAGGGCAAAGG - Intronic
1016989115 6:149917325-149917347 CTCTAACTCCCCCGGGGAAAGGG + Intronic
1017051301 6:150396305-150396327 CTCAGACCCCCAAAGGGCCAAGG - Intronic
1018025217 6:159800422-159800444 CTCAAGCTCGCCCGGGGCAAGGG - Intronic
1018596739 6:165488917-165488939 CTCAGACTCCCCTTGGGCAGGGG - Intronic
1019735584 7:2648401-2648423 CCCAGGCTGCCCCAGGGCCAAGG - Intronic
1019938810 7:4273420-4273442 CTGGGACTCCACCAGGGGAATGG - Intergenic
1021480644 7:21111859-21111881 TTCAGCCTCCTCCAGGGAAAAGG - Intergenic
1021845290 7:24757431-24757453 CTCCGACTCCGCCAGCGCAGGGG - Intronic
1022045752 7:26620968-26620990 CTCTGACTCTCACAGGGCCAGGG + Intergenic
1023868500 7:44250227-44250249 CTCAGATTGCACCAGGACAAGGG - Intronic
1024272562 7:47653723-47653745 CTCAGGCTCCTCCAGGCCCATGG + Intergenic
1024643505 7:51351871-51351893 CTCAGCCTCCCCAGGGGAAATGG + Intergenic
1026957632 7:74387690-74387712 CTCAGACTCCTCCAAGGCCAAGG + Intronic
1028322212 7:89474435-89474457 CTCAGTCTCTTCCAGGGTAAAGG + Intergenic
1029381470 7:100217998-100218020 CTCTAACTCCCCCAGGGAAAGGG + Intronic
1029400902 7:100345311-100345333 CTCTAACTCCCCCAGGGAAAGGG + Intronic
1029629972 7:101744039-101744061 CCCAGTCTCCCTGAGGGCAAGGG - Intergenic
1029667550 7:102005585-102005607 CTCAGCCTCCCACAGGGCTGGGG + Intronic
1031963736 7:128012393-128012415 CTCTGGCTACACCAGGGCAATGG + Intronic
1032189382 7:129755059-129755081 ACCAGCCTCGCCCAGGGCAACGG + Exonic
1035958638 8:4112307-4112329 CACAGACTCCACCCTGGCAACGG + Intronic
1036439325 8:8766300-8766322 CTCAGACTCTACCAGGCCACTGG + Intergenic
1037735331 8:21561311-21561333 CTCAGAGGCCCCTAAGGCAAGGG - Intergenic
1039704854 8:39996135-39996157 CTCTAACTCCCCCGGGGAAAGGG - Intronic
1039879761 8:41617688-41617710 CTCAGGCTTTCCCAGGGAAAGGG + Intronic
1040323393 8:46329482-46329504 CCCAGGCACCCCCAGGGTAAGGG - Intergenic
1041671059 8:60492404-60492426 CCCTGACTCCCCCAGGGGAGAGG - Intergenic
1042099331 8:65257591-65257613 CACAGCCTCCCCAGGGGCAATGG - Intergenic
1042149578 8:65767603-65767625 CCCAGATTCCCCCAGGGTATGGG - Intronic
1042603056 8:70518284-70518306 CTCAGCCTCCCCAAGTGCAAGGG + Intergenic
1044971526 8:97624808-97624830 CTCAGACTCCTCCATGGGCAGGG + Intergenic
1046192939 8:110822393-110822415 CTCTAACTCCCCCAGGGAAAGGG - Intergenic
1046638876 8:116703363-116703385 CTCTAACTCCCCCGGGGAAAGGG - Intronic
1047492443 8:125386098-125386120 CTCAGACTCCCCGAGCGCCTCGG + Intergenic
1048584183 8:135757258-135757280 CTCCAACTCCCCCAGGCCAGCGG - Intergenic
1049437987 8:142596424-142596446 CTCGGGCTCCCCTAGGGCAGGGG - Intergenic
1049778235 8:144416050-144416072 CTCAGGCTCGCCCAGGCCCAGGG + Exonic
1050021797 9:1292157-1292179 CTCAGACACCCCCAGAGGAAAGG + Intergenic
1050219258 9:3367637-3367659 TTCAGAATTCCCCAGGGAAAAGG + Intronic
1050533694 9:6612480-6612502 CTCAGCCTCCCAGAGTGCAAGGG - Intronic
1052690921 9:31815991-31816013 GTCAGAGTCACCCAGGACAATGG - Intergenic
1052986384 9:34491090-34491112 CTCTGGCTCCACCAGGGGAATGG - Intronic
1053072649 9:35110378-35110400 CCCTGGCTTCCCCAGGGCAAGGG - Exonic
1055589607 9:77797892-77797914 CTCATACTCCCCAGAGGCAAGGG + Intronic
1056398411 9:86203266-86203288 CTCTGACTCACCCTGGGGAAGGG - Intergenic
1056683651 9:88741909-88741931 CACAGACTCCCACAGAGAAAAGG - Intergenic
1058924485 9:109648976-109648998 CTCAGACCTTCCCAGAGCAAGGG - Intronic
1059257504 9:112944869-112944891 GTCAGACTCCCCCTGCCCAAAGG + Intergenic
1060784434 9:126439062-126439084 GTCCGATTCCCCCAGGGCTAAGG - Intronic
1061779370 9:132986767-132986789 CTCTGACTCACCCGGGGTAAGGG - Exonic
1061787805 9:133041211-133041233 TCCAAACTCCCCCAGGGAAAGGG - Intronic
1061790234 9:133055293-133055315 CTCGGCCTCCCCCAGGGCTGTGG - Intronic
1062062205 9:134502635-134502657 CTCAGACTCCACCAGGGGCCGGG - Intergenic
1062070300 9:134551899-134551921 CCCAGACTCCCCGTGGACAAGGG + Intergenic
1062247227 9:135575398-135575420 CCCAGCCTCTCCCAGGGCCAGGG + Intergenic
1062273061 9:135718523-135718545 CTGAGACACCCCCATGGCCAAGG - Intronic
1062404481 9:136388652-136388674 CTCTGAGTGCCCCAGGGCACAGG + Intronic
1062503403 9:136860944-136860966 CACAGACCCACCCAGGACAAGGG + Intronic
1203431106 Un_GL000195v1:92093-92115 CTCCTAATCCCCCAGGACAAAGG + Intergenic
1203435403 Un_GL000195v1:132530-132552 CTCCTAATCCCCCAGGACAAAGG - Intergenic
1185489771 X:512104-512126 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185489783 X:512148-512170 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185489795 X:512192-512214 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185489859 X:512412-512434 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185489871 X:512456-512478 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185489922 X:512632-512654 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185489934 X:512676-512698 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185489946 X:512720-512742 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185489971 X:512808-512830 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185489995 X:512896-512918 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490007 X:512940-512962 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490019 X:512984-513006 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490044 X:513072-513094 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490056 X:513116-513138 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490081 X:513204-513226 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490093 X:513248-513270 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490105 X:513292-513314 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490117 X:513336-513358 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490155 X:513468-513490 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490206 X:513644-513666 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490218 X:513688-513710 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490256 X:513820-513842 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490268 X:513864-513886 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490280 X:513908-513930 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490292 X:513952-513974 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490317 X:514040-514062 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490329 X:514084-514106 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490341 X:514128-514150 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490353 X:514172-514194 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490378 X:514260-514282 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490390 X:514304-514326 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490402 X:514348-514370 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490427 X:514436-514458 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490452 X:514524-514546 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490464 X:514568-514590 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490476 X:514612-514634 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490488 X:514656-514678 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490500 X:514700-514722 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490512 X:514744-514766 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490537 X:514832-514854 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490549 X:514876-514898 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490561 X:514920-514942 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490573 X:514964-514986 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490598 X:515052-515074 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490610 X:515096-515118 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490635 X:515184-515206 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490647 X:515228-515250 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490685 X:515360-515382 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490697 X:515404-515426 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490722 X:515492-515514 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490734 X:515536-515558 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490746 X:515580-515602 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490758 X:515624-515646 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490783 X:515712-515734 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490795 X:515756-515778 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490820 X:515844-515866 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490832 X:515888-515910 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185490844 X:515932-515954 CTCTCACTCCCACAGGGAAAGGG - Intergenic
1185599263 X:1327784-1327806 CTCAGAGCCCCCCAGGGCAGGGG - Intergenic
1186047979 X:5556826-5556848 CTCACAGTTCCCCAGGGCTAGGG - Intergenic
1186610516 X:11134255-11134277 CTCACACTGCCACATGGCAAAGG + Intergenic
1190319519 X:49171993-49172015 CTCAGAATCCGCCATGGCATGGG - Exonic
1191785738 X:64915586-64915608 CTCAGGCTCACTCTGGGCAAAGG - Intergenic
1194542876 X:95196428-95196450 CTCAGACCCCTCCAGTGCAGTGG - Intergenic
1195244326 X:102981912-102981934 TGCAAACTCCTCCAGGGCAAAGG - Intergenic
1195791699 X:108595234-108595256 CTCACACTCTACCAGGGGAAAGG - Intronic
1195941538 X:110171852-110171874 AGAAGACTCCCCCAGGCCAAGGG - Intronic
1198224766 X:134635076-134635098 GTCAGACTATCCCAGGGAAAGGG - Intronic
1198272320 X:135066458-135066480 CTCTAACTCCCCCAGGGGAAAGG - Intergenic
1199890188 X:152071405-152071427 TTAAGACTCACCCAGGGCATAGG - Intergenic
1200256799 X:154586636-154586658 CTCAGCCTCCCTCAGGGCAGAGG + Exonic
1200260970 X:154617767-154617789 CTCAGCCTCCCTCAGGGCAGAGG - Exonic
1200267011 X:154652135-154652157 CTCAGGCTCCCTCAGGGCAGAGG - Exonic
1200412653 Y:2876904-2876926 CTCTAAATCCCCCAGGGAAAGGG - Intronic
1200953961 Y:8927223-8927245 CTCACCCTCCCACATGGCAAGGG - Intergenic
1200986546 Y:9307039-9307061 CTCACCCTCCCACATGGCAAGGG + Intergenic
1201423527 Y:13825108-13825130 CTCTAAATCCCCCAGGGAAAGGG - Intergenic
1201541770 Y:15112448-15112470 CTCTAACTCCTCCAGGGAAAGGG + Intergenic
1202199410 Y:22331067-22331089 CTCACCCTCCCGCATGGCAAGGG - Intronic
1202232066 Y:22668603-22668625 CTCACCCTCCCACATGGCAAGGG - Intergenic
1202311090 Y:23527555-23527577 CTCACCCTCCCACATGGCAAGGG + Intergenic
1202559712 Y:26143039-26143061 CTCACCCTCCCACATGGCAAGGG - Intergenic