ID: 1148625277

View in Genome Browser
Species Human (GRCh38)
Location 17:49064594-49064616
Sequence ATTCACATGGGTCATGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148625277_1148625284 2 Left 1148625277 17:49064594-49064616 CCCACTTCATGACCCATGTGAAT No data
Right 1148625284 17:49064619-49064641 CCCTCAGAAAGGACCCTTCAAGG No data
1148625277_1148625281 -9 Left 1148625277 17:49064594-49064616 CCCACTTCATGACCCATGTGAAT No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148625277 Original CRISPR ATTCACATGGGTCATGAAGT GGG (reversed) Intergenic
No off target data available for this crispr