ID: 1148625281

View in Genome Browser
Species Human (GRCh38)
Location 17:49064608-49064630
Sequence CATGTGAATGCCCCTCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148625270_1148625281 15 Left 1148625270 17:49064570-49064592 CCAATGTAGCCTGTTACCCCTAC No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625267_1148625281 23 Left 1148625267 17:49064562-49064584 CCACCCGGCCAATGTAGCCTGTT No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625271_1148625281 6 Left 1148625271 17:49064579-49064601 CCTGTTACCCCTACCCCCACTTC No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625275_1148625281 -7 Left 1148625275 17:49064592-49064614 CCCCCACTTCATGACCCATGTGA No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625265_1148625281 25 Left 1148625265 17:49064560-49064582 CCCCACCCGGCCAATGTAGCCTG No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625278_1148625281 -10 Left 1148625278 17:49064595-49064617 CCACTTCATGACCCATGTGAATG No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625266_1148625281 24 Left 1148625266 17:49064561-49064583 CCCACCCGGCCAATGTAGCCTGT No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625274_1148625281 -3 Left 1148625274 17:49064588-49064610 CCTACCCCCACTTCATGACCCAT No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625268_1148625281 20 Left 1148625268 17:49064565-49064587 CCCGGCCAATGTAGCCTGTTACC No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625273_1148625281 -2 Left 1148625273 17:49064587-49064609 CCCTACCCCCACTTCATGACCCA No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625276_1148625281 -8 Left 1148625276 17:49064593-49064615 CCCCACTTCATGACCCATGTGAA No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625272_1148625281 -1 Left 1148625272 17:49064586-49064608 CCCCTACCCCCACTTCATGACCC No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625269_1148625281 19 Left 1148625269 17:49064566-49064588 CCGGCCAATGTAGCCTGTTACCC No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data
1148625277_1148625281 -9 Left 1148625277 17:49064594-49064616 CCCACTTCATGACCCATGTGAAT No data
Right 1148625281 17:49064608-49064630 CATGTGAATGCCCCTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148625281 Original CRISPR CATGTGAATGCCCCTCAGAA AGG Intergenic
No off target data available for this crispr