ID: 1148627581

View in Genome Browser
Species Human (GRCh38)
Location 17:49081537-49081559
Sequence GACTTTGTGAATATCGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148627581_1148627584 2 Left 1148627581 17:49081537-49081559 CCTTCCTCGATATTCACAAAGTC No data
Right 1148627584 17:49081562-49081584 TCCTTTTTCATCCTCCTCCTTGG No data
1148627581_1148627586 3 Left 1148627581 17:49081537-49081559 CCTTCCTCGATATTCACAAAGTC No data
Right 1148627586 17:49081563-49081585 CCTTTTTCATCCTCCTCCTTGGG No data
1148627581_1148627592 24 Left 1148627581 17:49081537-49081559 CCTTCCTCGATATTCACAAAGTC No data
Right 1148627592 17:49081584-49081606 GGCACTGTGGAAGAGGACACTGG No data
1148627581_1148627587 11 Left 1148627581 17:49081537-49081559 CCTTCCTCGATATTCACAAAGTC No data
Right 1148627587 17:49081571-49081593 ATCCTCCTCCTTGGGCACTGTGG No data
1148627581_1148627590 17 Left 1148627581 17:49081537-49081559 CCTTCCTCGATATTCACAAAGTC No data
Right 1148627590 17:49081577-49081599 CTCCTTGGGCACTGTGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148627581 Original CRISPR GACTTTGTGAATATCGAGGA AGG (reversed) Intergenic
No off target data available for this crispr