ID: 1148627584

View in Genome Browser
Species Human (GRCh38)
Location 17:49081562-49081584
Sequence TCCTTTTTCATCCTCCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148627582_1148627584 -2 Left 1148627582 17:49081541-49081563 CCTCGATATTCACAAAGTCCTTC No data
Right 1148627584 17:49081562-49081584 TCCTTTTTCATCCTCCTCCTTGG No data
1148627581_1148627584 2 Left 1148627581 17:49081537-49081559 CCTTCCTCGATATTCACAAAGTC No data
Right 1148627584 17:49081562-49081584 TCCTTTTTCATCCTCCTCCTTGG No data
1148627580_1148627584 22 Left 1148627580 17:49081517-49081539 CCTGAGTGTTCTTCTTGTCACCT No data
Right 1148627584 17:49081562-49081584 TCCTTTTTCATCCTCCTCCTTGG No data
1148627579_1148627584 23 Left 1148627579 17:49081516-49081538 CCCTGAGTGTTCTTCTTGTCACC No data
Right 1148627584 17:49081562-49081584 TCCTTTTTCATCCTCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148627584 Original CRISPR TCCTTTTTCATCCTCCTCCT TGG Intergenic
No off target data available for this crispr