ID: 1148627586

View in Genome Browser
Species Human (GRCh38)
Location 17:49081563-49081585
Sequence CCTTTTTCATCCTCCTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148627582_1148627586 -1 Left 1148627582 17:49081541-49081563 CCTCGATATTCACAAAGTCCTTC No data
Right 1148627586 17:49081563-49081585 CCTTTTTCATCCTCCTCCTTGGG No data
1148627581_1148627586 3 Left 1148627581 17:49081537-49081559 CCTTCCTCGATATTCACAAAGTC No data
Right 1148627586 17:49081563-49081585 CCTTTTTCATCCTCCTCCTTGGG No data
1148627579_1148627586 24 Left 1148627579 17:49081516-49081538 CCCTGAGTGTTCTTCTTGTCACC No data
Right 1148627586 17:49081563-49081585 CCTTTTTCATCCTCCTCCTTGGG No data
1148627580_1148627586 23 Left 1148627580 17:49081517-49081539 CCTGAGTGTTCTTCTTGTCACCT No data
Right 1148627586 17:49081563-49081585 CCTTTTTCATCCTCCTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148627586 Original CRISPR CCTTTTTCATCCTCCTCCTT GGG Intergenic
No off target data available for this crispr