ID: 1148627587

View in Genome Browser
Species Human (GRCh38)
Location 17:49081571-49081593
Sequence ATCCTCCTCCTTGGGCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148627582_1148627587 7 Left 1148627582 17:49081541-49081563 CCTCGATATTCACAAAGTCCTTC No data
Right 1148627587 17:49081571-49081593 ATCCTCCTCCTTGGGCACTGTGG No data
1148627581_1148627587 11 Left 1148627581 17:49081537-49081559 CCTTCCTCGATATTCACAAAGTC No data
Right 1148627587 17:49081571-49081593 ATCCTCCTCCTTGGGCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148627587 Original CRISPR ATCCTCCTCCTTGGGCACTG TGG Intergenic
No off target data available for this crispr